ID: 927146742

View in Genome Browser
Species Human (GRCh38)
Location 2:20171136-20171158
Sequence CTCACACCCGAAGGAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146738_927146742 -8 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146742 2:20171136-20171158 CTCACACCCGAAGGAGGAACAGG No data
927146737_927146742 -7 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146742 2:20171136-20171158 CTCACACCCGAAGGAGGAACAGG No data
927146736_927146742 -3 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146742 2:20171136-20171158 CTCACACCCGAAGGAGGAACAGG No data
927146735_927146742 -2 Left 927146735 2:20171115-20171137 CCCTGCCCTCTTTTCCTTCTGCT No data
Right 927146742 2:20171136-20171158 CTCACACCCGAAGGAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146742 Original CRISPR CTCACACCCGAAGGAGGAAC AGG Intergenic
No off target data available for this crispr