ID: 927146744

View in Genome Browser
Species Human (GRCh38)
Location 2:20171143-20171165
Sequence CGATGCACCTGTTCCTCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146744_927146749 14 Left 927146744 2:20171143-20171165 CCGAAGGAGGAACAGGTGCATCG No data
Right 927146749 2:20171180-20171202 AGAGAGTTTGGAAAAGTCCCTGG No data
927146744_927146748 2 Left 927146744 2:20171143-20171165 CCGAAGGAGGAACAGGTGCATCG No data
Right 927146748 2:20171168-20171190 ACTGCAGGAGGAAGAGAGTTTGG No data
927146744_927146747 -10 Left 927146744 2:20171143-20171165 CCGAAGGAGGAACAGGTGCATCG No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146744 Original CRISPR CGATGCACCTGTTCCTCCTT CGG (reversed) Intergenic
No off target data available for this crispr