ID: 927146745

View in Genome Browser
Species Human (GRCh38)
Location 2:20171144-20171166
Sequence CGAAGGAGGAACAGGTGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146737_927146745 1 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data
927146735_927146745 6 Left 927146735 2:20171115-20171137 CCCTGCCCTCTTTTCCTTCTGCT No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data
927146740_927146745 -8 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data
927146736_927146745 5 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data
927146738_927146745 0 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146745 2:20171144-20171166 CGAAGGAGGAACAGGTGCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146745 Original CRISPR CGAAGGAGGAACAGGTGCAT CGG Intergenic
No off target data available for this crispr