ID: 927146747

View in Genome Browser
Species Human (GRCh38)
Location 2:20171156-20171178
Sequence AGGTGCATCGGAACTGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146738_927146747 12 Left 927146738 2:20171121-20171143 CCTCTTTTCCTTCTGCTCACACC No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146744_927146747 -10 Left 927146744 2:20171143-20171165 CCGAAGGAGGAACAGGTGCATCG No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146736_927146747 17 Left 927146736 2:20171116-20171138 CCTGCCCTCTTTTCCTTCTGCTC No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146737_927146747 13 Left 927146737 2:20171120-20171142 CCCTCTTTTCCTTCTGCTCACAC No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146740_927146747 4 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146735_927146747 18 Left 927146735 2:20171115-20171137 CCCTGCCCTCTTTTCCTTCTGCT No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data
927146743_927146747 -9 Left 927146743 2:20171142-20171164 CCCGAAGGAGGAACAGGTGCATC No data
Right 927146747 2:20171156-20171178 AGGTGCATCGGAACTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146747 Original CRISPR AGGTGCATCGGAACTGCAGG AGG Intergenic
No off target data available for this crispr