ID: 927146749

View in Genome Browser
Species Human (GRCh38)
Location 2:20171180-20171202
Sequence AGAGAGTTTGGAAAAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927146740_927146749 28 Left 927146740 2:20171129-20171151 CCTTCTGCTCACACCCGAAGGAG No data
Right 927146749 2:20171180-20171202 AGAGAGTTTGGAAAAGTCCCTGG No data
927146744_927146749 14 Left 927146744 2:20171143-20171165 CCGAAGGAGGAACAGGTGCATCG No data
Right 927146749 2:20171180-20171202 AGAGAGTTTGGAAAAGTCCCTGG No data
927146743_927146749 15 Left 927146743 2:20171142-20171164 CCCGAAGGAGGAACAGGTGCATC No data
Right 927146749 2:20171180-20171202 AGAGAGTTTGGAAAAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927146749 Original CRISPR AGAGAGTTTGGAAAAGTCCC TGG Intergenic
No off target data available for this crispr