ID: 927147120

View in Genome Browser
Species Human (GRCh38)
Location 2:20173537-20173559
Sequence CTCAATAAGCAAATGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927147114_927147120 9 Left 927147114 2:20173505-20173527 CCTACTCCTGTGCCCGGCACACA No data
Right 927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG No data
927147116_927147120 3 Left 927147116 2:20173511-20173533 CCTGTGCCCGGCACACATGGTAG No data
Right 927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG No data
927147118_927147120 -4 Left 927147118 2:20173518-20173540 CCGGCACACATGGTAGATCCTCA No data
Right 927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG No data
927147111_927147120 16 Left 927147111 2:20173498-20173520 CCCAGCACCTACTCCTGTGCCCG No data
Right 927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG No data
927147112_927147120 15 Left 927147112 2:20173499-20173521 CCAGCACCTACTCCTGTGCCCGG No data
Right 927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG No data
927147117_927147120 -3 Left 927147117 2:20173517-20173539 CCCGGCACACATGGTAGATCCTC No data
Right 927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927147120 Original CRISPR CTCAATAAGCAAATGAATGA AGG Intergenic
No off target data available for this crispr