ID: 927148636

View in Genome Browser
Species Human (GRCh38)
Location 2:20183208-20183230
Sequence AGCTACTGGGGACCCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927148632_927148636 -5 Left 927148632 2:20183190-20183212 CCTGTGGACAGACAACTCAGCTA No data
Right 927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG No data
927148626_927148636 14 Left 927148626 2:20183171-20183193 CCACAGGCTCCCTCACCCTCCTG No data
Right 927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG No data
927148630_927148636 -1 Left 927148630 2:20183186-20183208 CCCTCCTGTGGACAGACAACTCA No data
Right 927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG No data
927148631_927148636 -2 Left 927148631 2:20183187-20183209 CCTCCTGTGGACAGACAACTCAG No data
Right 927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG No data
927148624_927148636 30 Left 927148624 2:20183155-20183177 CCTGAGCAGACAGCATCCACAGG No data
Right 927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG No data
927148629_927148636 4 Left 927148629 2:20183181-20183203 CCTCACCCTCCTGTGGACAGACA No data
Right 927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG No data
927148628_927148636 5 Left 927148628 2:20183180-20183202 CCCTCACCCTCCTGTGGACAGAC No data
Right 927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927148636 Original CRISPR AGCTACTGGGGACCCCCAGA AGG Intergenic
No off target data available for this crispr