ID: 927149155

View in Genome Browser
Species Human (GRCh38)
Location 2:20185894-20185916
Sequence AGTGTGCTCTCATGAGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149155_927149165 17 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149155_927149168 27 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data
927149155_927149169 28 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149169 2:20185945-20185967 CATCTCTGCGGGTGCTGCAGGGG No data
927149155_927149163 16 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149163 2:20185933-20185955 GCCTGCTTTAGCCATCTCTGCGG No data
927149155_927149158 -10 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149158 2:20185907-20185929 AGAGCACACTGTGCCCTTTGAGG No data
927149155_927149166 26 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data
927149155_927149160 -6 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149155_927149159 -9 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149159 2:20185908-20185930 GAGCACACTGTGCCCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149155 Original CRISPR AGTGTGCTCTCATGAGTCAG GGG (reversed) Intergenic
No off target data available for this crispr