ID: 927149157

View in Genome Browser
Species Human (GRCh38)
Location 2:20185896-20185918
Sequence ACAGTGTGCTCTCATGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149157_927149165 15 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149157_927149163 14 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149163 2:20185933-20185955 GCCTGCTTTAGCCATCTCTGCGG No data
927149157_927149168 25 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data
927149157_927149160 -8 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149157_927149169 26 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149169 2:20185945-20185967 CATCTCTGCGGGTGCTGCAGGGG No data
927149157_927149166 24 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149157 Original CRISPR ACAGTGTGCTCTCATGAGTC AGG (reversed) Intergenic
No off target data available for this crispr