ID: 927149158

View in Genome Browser
Species Human (GRCh38)
Location 2:20185907-20185929
Sequence AGAGCACACTGTGCCCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149153_927149158 -1 Left 927149153 2:20185885-20185907 CCAGCCTGGCCCCTGACTCATGA No data
Right 927149158 2:20185907-20185929 AGAGCACACTGTGCCCTTTGAGG No data
927149155_927149158 -10 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149158 2:20185907-20185929 AGAGCACACTGTGCCCTTTGAGG No data
927149154_927149158 -5 Left 927149154 2:20185889-20185911 CCTGGCCCCTGACTCATGAGAGC No data
Right 927149158 2:20185907-20185929 AGAGCACACTGTGCCCTTTGAGG No data
927149152_927149158 0 Left 927149152 2:20185884-20185906 CCCAGCCTGGCCCCTGACTCATG No data
Right 927149158 2:20185907-20185929 AGAGCACACTGTGCCCTTTGAGG No data
927149151_927149158 1 Left 927149151 2:20185883-20185905 CCCCAGCCTGGCCCCTGACTCAT No data
Right 927149158 2:20185907-20185929 AGAGCACACTGTGCCCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149158 Original CRISPR AGAGCACACTGTGCCCTTTG AGG Intergenic
No off target data available for this crispr