ID: 927149160

View in Genome Browser
Species Human (GRCh38)
Location 2:20185911-20185933
Sequence CACACTGTGCCCTTTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149151_927149160 5 Left 927149151 2:20185883-20185905 CCCCAGCCTGGCCCCTGACTCAT No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149156_927149160 -7 Left 927149156 2:20185895-20185917 CCCTGACTCATGAGAGCACACTG No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149152_927149160 4 Left 927149152 2:20185884-20185906 CCCAGCCTGGCCCCTGACTCATG No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149155_927149160 -6 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149153_927149160 3 Left 927149153 2:20185885-20185907 CCAGCCTGGCCCCTGACTCATGA No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149154_927149160 -1 Left 927149154 2:20185889-20185911 CCTGGCCCCTGACTCATGAGAGC No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data
927149157_927149160 -8 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149160 2:20185911-20185933 CACACTGTGCCCTTTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149160 Original CRISPR CACACTGTGCCCTTTGAGGG TGG Intergenic
No off target data available for this crispr