ID: 927149162

View in Genome Browser
Species Human (GRCh38)
Location 2:20185921-20185943
Sequence CTAAAGCAGGCCACCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149162_927149171 8 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149171 2:20185952-20185974 GCGGGTGCTGCAGGGGAACAGGG No data
927149162_927149166 -1 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data
927149162_927149172 16 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149172 2:20185960-20185982 TGCAGGGGAACAGGGAAATGAGG No data
927149162_927149168 0 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data
927149162_927149165 -10 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149162_927149170 7 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149170 2:20185951-20185973 TGCGGGTGCTGCAGGGGAACAGG No data
927149162_927149169 1 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149169 2:20185945-20185967 CATCTCTGCGGGTGCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149162 Original CRISPR CTAAAGCAGGCCACCCTCAA AGG (reversed) Intergenic
No off target data available for this crispr