ID: 927149165

View in Genome Browser
Species Human (GRCh38)
Location 2:20185934-20185956
Sequence CCTGCTTTAGCCATCTCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149153_927149165 26 Left 927149153 2:20185885-20185907 CCAGCCTGGCCCCTGACTCATGA No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149156_927149165 16 Left 927149156 2:20185895-20185917 CCCTGACTCATGAGAGCACACTG No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149152_927149165 27 Left 927149152 2:20185884-20185906 CCCAGCCTGGCCCCTGACTCATG No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149154_927149165 22 Left 927149154 2:20185889-20185911 CCTGGCCCCTGACTCATGAGAGC No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149162_927149165 -10 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149157_927149165 15 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149155_927149165 17 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149161_927149165 -9 Left 927149161 2:20185920-20185942 CCCTTTGAGGGTGGCCTGCTTTA No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data
927149151_927149165 28 Left 927149151 2:20185883-20185905 CCCCAGCCTGGCCCCTGACTCAT No data
Right 927149165 2:20185934-20185956 CCTGCTTTAGCCATCTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149165 Original CRISPR CCTGCTTTAGCCATCTCTGC GGG Intergenic
No off target data available for this crispr