ID: 927149166

View in Genome Browser
Species Human (GRCh38)
Location 2:20185943-20185965
Sequence GCCATCTCTGCGGGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149162_927149166 -1 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data
927149155_927149166 26 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data
927149157_927149166 24 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data
927149161_927149166 0 Left 927149161 2:20185920-20185942 CCCTTTGAGGGTGGCCTGCTTTA No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data
927149156_927149166 25 Left 927149156 2:20185895-20185917 CCCTGACTCATGAGAGCACACTG No data
Right 927149166 2:20185943-20185965 GCCATCTCTGCGGGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149166 Original CRISPR GCCATCTCTGCGGGTGCTGC AGG Intergenic
No off target data available for this crispr