ID: 927149168

View in Genome Browser
Species Human (GRCh38)
Location 2:20185944-20185966
Sequence CCATCTCTGCGGGTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927149161_927149168 1 Left 927149161 2:20185920-20185942 CCCTTTGAGGGTGGCCTGCTTTA No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data
927149157_927149168 25 Left 927149157 2:20185896-20185918 CCTGACTCATGAGAGCACACTGT No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data
927149162_927149168 0 Left 927149162 2:20185921-20185943 CCTTTGAGGGTGGCCTGCTTTAG No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data
927149155_927149168 27 Left 927149155 2:20185894-20185916 CCCCTGACTCATGAGAGCACACT No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data
927149156_927149168 26 Left 927149156 2:20185895-20185917 CCCTGACTCATGAGAGCACACTG No data
Right 927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927149168 Original CRISPR CCATCTCTGCGGGTGCTGCA GGG Intergenic
No off target data available for this crispr