ID: 927151277

View in Genome Browser
Species Human (GRCh38)
Location 2:20197880-20197902
Sequence CTGGTGGTGGGAGGTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927151263_927151277 16 Left 927151263 2:20197841-20197863 CCCACAACACGACGTTGCCCATC No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data
927151265_927151277 -1 Left 927151265 2:20197858-20197880 CCCATCCCTAAAAGCAGCCTTTC No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data
927151262_927151277 17 Left 927151262 2:20197840-20197862 CCCCACAACACGACGTTGCCCAT No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data
927151264_927151277 15 Left 927151264 2:20197842-20197864 CCACAACACGACGTTGCCCATCC No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data
927151266_927151277 -2 Left 927151266 2:20197859-20197881 CCATCCCTAAAAGCAGCCTTTCT No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data
927151269_927151277 -7 Left 927151269 2:20197864-20197886 CCTAAAAGCAGCCTTTCTGGTGG No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data
927151268_927151277 -6 Left 927151268 2:20197863-20197885 CCCTAAAAGCAGCCTTTCTGGTG No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data
927151261_927151277 30 Left 927151261 2:20197827-20197849 CCTAGGGACATCTCCCCACAACA No data
Right 927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927151277 Original CRISPR CTGGTGGTGGGAGGTGGGTG TGG Intergenic
No off target data available for this crispr