ID: 927152159

View in Genome Browser
Species Human (GRCh38)
Location 2:20202485-20202507
Sequence TTGGAGAAACCGAGTCAGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 227}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927152148_927152159 18 Left 927152148 2:20202444-20202466 CCTCCCCTCCAGAGCTGGACCTG 0: 1
1: 0
2: 4
3: 23
4: 347
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152157_927152159 -1 Left 927152157 2:20202463-20202485 CCTGGGGAGAGGCTGCTTCAGTT 0: 1
1: 0
2: 1
3: 18
4: 236
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152145_927152159 21 Left 927152145 2:20202441-20202463 CCCCCTCCCCTCCAGAGCTGGAC 0: 1
1: 0
2: 10
3: 54
4: 409
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152153_927152159 14 Left 927152153 2:20202448-20202470 CCCTCCAGAGCTGGACCTGGGGA 0: 1
1: 0
2: 2
3: 27
4: 281
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152154_927152159 13 Left 927152154 2:20202449-20202471 CCTCCAGAGCTGGACCTGGGGAG 0: 1
1: 0
2: 2
3: 28
4: 280
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152155_927152159 10 Left 927152155 2:20202452-20202474 CCAGAGCTGGACCTGGGGAGAGG 0: 1
1: 0
2: 7
3: 45
4: 527
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152147_927152159 19 Left 927152147 2:20202443-20202465 CCCTCCCCTCCAGAGCTGGACCT 0: 1
1: 0
2: 4
3: 37
4: 333
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152146_927152159 20 Left 927152146 2:20202442-20202464 CCCCTCCCCTCCAGAGCTGGACC 0: 1
1: 0
2: 3
3: 42
4: 383
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227
927152151_927152159 15 Left 927152151 2:20202447-20202469 CCCCTCCAGAGCTGGACCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 299
Right 927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG 0: 1
1: 0
2: 0
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927152159 Original CRISPR TTGGAGAAACCGAGTCAGAA TGG Exonic
901522088 1:9792886-9792908 TTTGTGAAACGGAGTGAGAAGGG + Intronic
903226425 1:21896469-21896491 TTGGGGAAACTGAATCAAAAGGG - Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903575626 1:24337906-24337928 TTGGGGAAACTGAGGCAAAAGGG + Intronic
903669230 1:25025671-25025693 TTGGGGTAACAGAGTCACAAAGG - Intergenic
904342384 1:29845310-29845332 TTGGGGAATCCAAGTCAGAATGG + Intergenic
904399775 1:30248416-30248438 TTGGGGAATCCAAGTCAGAATGG - Intergenic
904452396 1:30622161-30622183 TGGGGGAATCCAAGTCAGAATGG - Intergenic
904999100 1:34654197-34654219 GTCGAGAAAGCAAGTCAGAAGGG + Intergenic
905110884 1:35593620-35593642 CTGGAGAAACCTAGCCAGGACGG + Intronic
906679033 1:47712464-47712486 ATGGAGAAACCAAGGCAGGAAGG - Intergenic
908075858 1:60517208-60517230 TTGCACAAAACTAGTCAGAACGG + Intergenic
908102916 1:60809811-60809833 TTGGCATAACCAAGTCAGAAAGG + Intergenic
909138719 1:71835256-71835278 TTGGTGAAAGCAAGTCACAAGGG + Intronic
909992670 1:82241821-82241843 TAGGAGAAACACAGGCAGAATGG + Intergenic
914397482 1:147284452-147284474 TTGGAGAAAGCTAGTCAAGAGGG + Exonic
915899178 1:159834197-159834219 GTGGAGAAAGGGAGTCAGCAAGG + Intronic
915956101 1:160221261-160221283 TTAGAGAAAGGAAGTCAGAAGGG - Intronic
917110492 1:171542547-171542569 TAGGAGAAACTGAGAAAGAAGGG - Intronic
917790946 1:178498347-178498369 TTTGAGAAACCGAGGCAGGAGGG + Intergenic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
920454133 1:206085069-206085091 TTGAAGAAACTGAGGCAGCAAGG - Intronic
920904105 1:210143643-210143665 TTGGAGAAACTGGGTCGGCAGGG + Intronic
924757038 1:246950792-246950814 ATGAAGAAACCGAGACAGAGTGG - Intronic
1065102143 10:22341156-22341178 TTGGAGAAACTTAGGAAGAATGG + Intergenic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1069855818 10:71440458-71440480 CAGGAGAAACCCAGCCAGAAGGG + Intronic
1069920833 10:71814814-71814836 TTTGAGAAACAGAGTCTGACAGG + Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1071204738 10:83261232-83261254 TTGGAGACACGGAATCAGAGTGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1078512267 11:11994332-11994354 CTGAAGAAACCGAGTCACAAAGG + Intronic
1078761730 11:14257172-14257194 TTGAGGAAACTGAGACAGAAAGG - Intronic
1080663042 11:34312881-34312903 TAGGAGAAATCGCCTCAGAAGGG + Intronic
1081103836 11:39039325-39039347 TTGGGGAGAAGGAGTCAGAAGGG + Intergenic
1081718841 11:45271521-45271543 TTGGAGAAATGGAGTTGGAAAGG + Intronic
1081877104 11:46416098-46416120 TTGGAGAAACAGGGAAAGAAAGG + Intronic
1082984514 11:59157023-59157045 GAGGAGAAACCGAGAAAGAAAGG + Intergenic
1083875931 11:65524655-65524677 ATGGGGAAACCGAGGCAAAAAGG - Intergenic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1086727560 11:90207073-90207095 TTTGAGAAACTGAGTCTGTACGG - Intronic
1087655380 11:100916402-100916424 TTGGAAAATCAGTGTCAGAAAGG + Intronic
1088889574 11:114033903-114033925 TAGGAGAAAACTAGCCAGAAAGG - Intergenic
1090960128 11:131548857-131548879 TTGGGGACACTGAGACAGAAAGG + Intronic
1091198020 11:133748275-133748297 CTGAAGAAACTGAGTCTGAAAGG + Intergenic
1092752631 12:11733027-11733049 ATGGAGAAACAGAGTCTGAGTGG - Intronic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1095490714 12:42731100-42731122 TGGGAGACACGGAATCAGAATGG - Intergenic
1097089128 12:56491609-56491631 ATGGAGAAACTAAGGCAGAAAGG - Intergenic
1098590248 12:72202565-72202587 GTGGAGATAGCGAGCCAGAAAGG - Intronic
1099098869 12:78411566-78411588 TTTGAGAAATCGCATCAGAATGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1101426156 12:104590299-104590321 TAGGAGAATCTGATTCAGAAGGG + Intronic
1101453866 12:104809064-104809086 TTGGATATATAGAGTCAGAAAGG - Intronic
1101454023 12:104810711-104810733 TTGGAGAAATTGAGTCGGAGAGG + Intronic
1101593355 12:106141414-106141436 TTGAAGAAACCGTATCAGAAAGG + Intergenic
1102845261 12:116174584-116174606 TTGGAGAAACTTAGTCATTATGG - Intronic
1104977701 12:132559704-132559726 AAGGGGAAACTGAGTCAGAAAGG - Intronic
1108718957 13:53110515-53110537 TTGGAGAATTCTTGTCAGAAGGG - Intergenic
1108991521 13:56663796-56663818 TTGGAGAAAATAAGTCTGAACGG + Intergenic
1111847969 13:93535350-93535372 TTGGAGAAATTGAAACAGAAAGG + Intronic
1112608462 13:100931280-100931302 TTGAAGAGATCAAGTCAGAATGG + Intergenic
1112760904 13:102692256-102692278 TGGGAGAAACCTGGTCAGCAGGG + Intronic
1114867596 14:26616305-26616327 TTGGAAAAATAGAGTCAAAATGG + Intergenic
1114979962 14:28150484-28150506 TCGGAGAGGCCGAGGCAGAATGG - Intergenic
1118472817 14:66090747-66090769 TTGGAGAAACTGAGCCATAAAGG + Intergenic
1119635492 14:76269926-76269948 CTGGAGAAATTGAGCCAGAAAGG + Intergenic
1119782431 14:77285678-77285700 TTAGAGAAAACGTGTCAGAAAGG + Intronic
1120171991 14:81255392-81255414 ATTGAGGAACCGAGTAAGAATGG + Intergenic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1121009741 14:90512828-90512850 TTGGAGGAAGGGAGTCAGAGGGG + Intergenic
1124835688 15:33194411-33194433 CTGGAGGAACCGACACAGAAGGG + Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127488530 15:59440757-59440779 GTGGAGAAACAGAGTCACAGAGG - Intronic
1128159780 15:65416006-65416028 TTGGGGAAACTGAGGCTGAAAGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129599893 15:76992538-76992560 TTGGAGAAAATGAGACACAAGGG + Intergenic
1132538832 16:497880-497902 CCAAAGAAACCGAGTCAGAAAGG - Intronic
1132985303 16:2763315-2763337 TTGGAGAAGAGGAGCCAGAATGG - Exonic
1134492020 16:14702736-14702758 AAGGAGAAAGTGAGTCAGAATGG - Intergenic
1134497401 16:14741858-14741880 AAGGAGAAAGTGAGTCAGAATGG - Intronic
1135819298 16:25666765-25666787 TTGAAAATACAGAGTCAGAAGGG + Intergenic
1135976055 16:27109615-27109637 TTGGAGAAACGAAGGCGGAAAGG + Intergenic
1136153195 16:28365481-28365503 AAGGAGAAACTGAGGCAGAATGG + Intergenic
1136209891 16:28749792-28749814 AAGGAGAAACTGAGGCAGAATGG - Intergenic
1136278622 16:29193940-29193962 TTCAGGAAACTGAGTCAGAAAGG - Intergenic
1137688714 16:50404933-50404955 TTGGAGAAACTGAGGCATCAAGG - Intergenic
1139209979 16:65067849-65067871 TTGGAGAAAGGGAGGGAGAAAGG + Intronic
1139811843 16:69625802-69625824 TTGGATAAAACTAGACAGAATGG - Intronic
1141530437 16:84642938-84642960 ATGGAGAAACTGAGGCACAACGG + Intergenic
1141737975 16:85867821-85867843 TTGCGGAAACAGAGTCAGACTGG + Intergenic
1142083011 16:88160021-88160043 TTCAGGAAACTGAGTCAGAAAGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1146441358 17:32897962-32897984 TAGGAAAAACCAAGTCACAAAGG + Intergenic
1146946231 17:36875611-36875633 ATGGAGAAAGTGAGTCAGAGGGG + Intergenic
1149478854 17:56985668-56985690 TTGGAGAAGGCGAGGCAGACTGG - Intronic
1150427216 17:65086359-65086381 TTGGGGAAACTGAGTCACAGAGG - Intergenic
1150599568 17:66639026-66639048 TTGGAGAAACCCTGAGAGAAAGG + Intronic
1151115547 17:71730879-71730901 GTAAAGAAACTGAGTCAGAAAGG + Intergenic
1151546675 17:74797564-74797586 TTGGAGAAATCAAGGCAGATGGG + Intronic
1155532159 18:26778018-26778040 TTGGGATAACCGAGACAGAAAGG - Intergenic
1156021914 18:32609145-32609167 TTGGAGAAACCGTGGCTGGAAGG + Intergenic
1156628416 18:38938120-38938142 GTTTAGAAACCTAGTCAGAAAGG - Intergenic
1156739681 18:40309263-40309285 TTGGAGAAAAAGAGTCTCAAGGG + Intergenic
1159260134 18:66003681-66003703 TTGGACAGACCTAGCCAGAAGGG + Intergenic
1160720016 19:592933-592955 TTGGGGAAACTGAGGCAGAGGGG - Intronic
1161911772 19:7199264-7199286 TTGGAGAAACCGAGGCATAGAGG + Intronic
1162017767 19:7854804-7854826 GTGGGGAAACTGAGTCAGAGTGG - Intronic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1163657953 19:18558641-18558663 TTGAAAAAACTGATTCAGAAGGG + Intronic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1164903282 19:31946469-31946491 ATGGAGAGACTGAGGCAGAAAGG + Intergenic
1166705951 19:44908145-44908167 TGTGAGAGACTGAGTCAGAAGGG - Intronic
1166803478 19:45471626-45471648 ATGGAGAAACTGAGGCAAAATGG - Intronic
925038290 2:709014-709036 TTAGAAAGACCGAGTCAGGAAGG - Intergenic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG + Intergenic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG + Exonic
930158118 2:48126302-48126324 TTGTAGAATCCTAGGCAGAAAGG + Intergenic
936886238 2:117313178-117313200 TTAAATAAACCTAGTCAGAATGG + Intergenic
937261284 2:120588019-120588041 CTGAAGAAACCGAGGCAGAGAGG + Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
938046076 2:128122016-128122038 TTGAAGAAACTGAGTCATAGAGG + Intronic
939415601 2:141893088-141893110 TTACAGAAAATGAGTCAGAAGGG - Intronic
940986271 2:160055285-160055307 TGGGAGAAACGGAGTCAAGAAGG + Intronic
941332522 2:164196090-164196112 TGGGAGAAAACGAGGAAGAAAGG - Intergenic
942895668 2:181050718-181050740 GATGAGAAACCGAGCCAGAAAGG - Intronic
943520275 2:188940918-188940940 TTGGAGAAACCCAGCCAGTACGG - Intergenic
944893966 2:204145307-204145329 TTGGAGACACTGGGTCAGGAAGG - Intergenic
947252678 2:228125495-228125517 TTAGAGAATCTGAGTCAGACAGG + Intronic
948296151 2:236862175-236862197 TTTGAGAAACTGTGTCAGCATGG + Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1169529337 20:6467284-6467306 TTTGAGAGGCCGAGGCAGAAGGG + Intergenic
1172035286 20:32006345-32006367 TTGGACACACCGAGACAGCAGGG - Intergenic
1172291864 20:33782670-33782692 GTGGGGAAACCAAGGCAGAAAGG + Intronic
1173972325 20:47162310-47162332 TAGGAGAAAACGAGGCAGAGAGG - Intronic
1174252803 20:49232127-49232149 TTTGGGAAGCCGAGGCAGAAGGG - Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1175383079 20:58577105-58577127 TAGGAGAAACCCAGACAGCACGG + Intergenic
1175638237 20:60603335-60603357 TTGGAGAAACCGAGGCTCCAAGG - Intergenic
1177003575 21:15643197-15643219 TAGGAGAGTCAGAGTCAGAAGGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1180149889 21:45942129-45942151 GAGGGGAAACCGAGTCAGCATGG - Exonic
1180595512 22:16970380-16970402 ATGGAGAAACTAATTCAGAAAGG - Intronic
1181465679 22:23109443-23109465 TGGGAGAAAGGGAGTCAGACAGG + Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182250690 22:28997661-28997683 ATGGAGAAACGGAGGCAGAGAGG - Intronic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184093543 22:42304680-42304702 CTGGGGAAACCGAGGCAGAGAGG + Intronic
1184723966 22:46332329-46332351 GTGGAGAAACCCAGACAGAAAGG - Intronic
950153534 3:10706760-10706782 GTGGGGAAACTGAGTCAGAGAGG + Intronic
952027910 3:29105735-29105757 TTGAAGAAACTGAGGCATAAAGG - Intergenic
952909538 3:38170596-38170618 TTGAAGACACAGAGACAGAAAGG + Intronic
954807435 3:53228716-53228738 TTGGAGAACCCAACTCAGGAGGG + Intronic
954813114 3:53260084-53260106 TTCCAGAAACCGAGACACAAAGG + Intergenic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
955814055 3:62823071-62823093 TTGGAGAAACCAAGACAAAGTGG - Intronic
956066604 3:65403106-65403128 ATGGAGAAACTGAGACAGAGAGG - Intronic
956210249 3:66795105-66795127 TCGGAGAAGTCGTGTCAGAATGG + Intergenic
958169934 3:89926720-89926742 GTGGAGAAACGAAGGCAGAAAGG - Intergenic
960885345 3:122388215-122388237 TTGGAGATACTGAGTAAGGAAGG + Intronic
961105174 3:124234780-124234802 TTTAAGAAAACCAGTCAGAAAGG - Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961819252 3:129566869-129566891 TGGGGGAAACTGAGGCAGAAAGG + Intronic
962299120 3:134221988-134222010 ATGGAGAAACGGTGTAAGAAAGG - Intronic
962739651 3:138353873-138353895 TGAGAGAAGCAGAGTCAGAAAGG + Intronic
964199283 3:154099862-154099884 TTGGAGAAAACAAGTCATATGGG + Intergenic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
965068091 3:163878536-163878558 CTGGAGAATCCTAGTCAGACTGG - Intergenic
965129200 3:164673163-164673185 GTGGAGAAACATAGTCAAAAAGG - Intergenic
966051160 3:175618912-175618934 GTGGGAAGACCGAGTCAGAAGGG + Intronic
972714701 4:41633828-41633850 CTGGAGAAACAAAGTCACAAGGG - Intronic
974516006 4:62911893-62911915 TTGGAGAGCAAGAGTCAGAAAGG - Intergenic
976006506 4:80436633-80436655 ATGGAGAAAGGGAGGCAGAAAGG - Intronic
981119318 4:141030764-141030786 TTATAGAAACAGAATCAGAATGG + Intronic
983299614 4:165908660-165908682 TTGGAGATACAGAGTCAGAGAGG + Intronic
984481842 4:180314171-180314193 TTTCAGAAGCCGAGTCATAAAGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985286534 4:188341835-188341857 TAGGAGAAACTGAGTTAGGACGG - Intergenic
986104592 5:4647830-4647852 ATGAAGAAACCGAGGCAGAGAGG + Intergenic
986351314 5:6882354-6882376 TTGGAGAACGTGAGTAAGAAGGG - Intergenic
986635232 5:9815002-9815024 TCGGAGAAAGCGAGGCAGAATGG + Intergenic
986723814 5:10579717-10579739 TTAAAGAAACCTAGTGAGAAAGG + Intronic
987613148 5:20234819-20234841 TTGAAGAAACACAGACAGAAAGG + Intronic
991181923 5:63762188-63762210 ATGTAGAAACTGAGTCTGAAAGG - Intergenic
994154185 5:96484246-96484268 TTGGGGAAACTTAGTCATAATGG - Intergenic
995459554 5:112388547-112388569 TTGAAGAGACCGAGAGAGAATGG + Intronic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
998710736 5:144822104-144822126 TTTGAGAAACAGAGTCACACTGG + Intergenic
998872271 5:146564392-146564414 TAGGAGAAACCATCTCAGAATGG - Intergenic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
999596680 5:153212924-153212946 TTGAAGAAACCGAGGCATGAAGG - Intergenic
1001135336 5:169098023-169098045 TTGGGGAAAACCTGTCAGAAAGG + Intronic
1003452149 6:6244965-6244987 GTGGAGAAACTGAGTCACAGAGG + Intronic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1006131394 6:31871401-31871423 TTGGGGAGACAGAGTCAGATGGG + Intronic
1006495215 6:34417992-34418014 ATGGAGAAACTGAGGCAGAGGGG + Intronic
1013898922 6:115128697-115128719 TGGGATAAACAGAGACAGAATGG + Intergenic
1014595886 6:123338281-123338303 TTAGAGAAACAGAGAGAGAATGG + Intronic
1015544611 6:134348619-134348641 TTGGAGAAAGGGCCTCAGAAGGG - Intergenic
1016412844 6:143801801-143801823 GGGGAGAAACCAAGGCAGAAAGG - Intronic
1016615359 6:146041647-146041669 AAGGAGATACCGAGTCAGAGAGG - Intronic
1017148389 6:151255553-151255575 TTTGAGAAGCCGAGGCAGGAGGG + Intronic
1020483316 7:8689693-8689715 TTGGACAAACTCAGTCAGAAAGG + Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1021225403 7:18020610-18020632 TTGGAGAGACAGAGACACAAGGG - Intergenic
1021408655 7:20303502-20303524 TTGGAGCAACCCAGAAAGAAGGG + Intergenic
1021875983 7:25049733-25049755 TTAGAGAAAAGGAGTCAGTATGG - Intergenic
1026120563 7:67533287-67533309 TTGAAGGAACCATGTCAGAATGG - Intergenic
1026623001 7:71967386-71967408 TTTGGGAAACCAAGTCAGGATGG + Intronic
1026693308 7:72568960-72568982 TTGGGGAAGCCGAGTCAGGTGGG + Intronic
1028626105 7:92879594-92879616 TTGGAAAGACGTAGTCAGAAAGG - Intergenic
1030379281 7:108793927-108793949 TTTAAGAAACAGAGTAAGAAAGG - Intergenic
1037535074 8:19816808-19816830 TTGGAGAAACCGGTGCATAAAGG + Intergenic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1039928646 8:41962117-41962139 TTGGAGAAACTGAGAAGGAATGG - Intronic
1042704626 8:71653128-71653150 TTGGTAACACCGAGTCAGGAAGG - Intergenic
1043657122 8:82682063-82682085 TTTGAAAAAAAGAGTCAGAATGG - Intergenic
1044734506 8:95265914-95265936 TGTCAGAAACAGAGTCAGAAAGG - Intronic
1046929637 8:119829197-119829219 TTGGACCAACCCAGCCAGAAGGG - Intronic
1047820141 8:128510451-128510473 TGGGAGAAACCGAGGCACAGGGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1050271814 9:3954212-3954234 TTGGAGAAACTGAGGCACCAGGG + Intronic
1050447589 9:5741760-5741782 TGGCAGAAACAGACTCAGAAAGG - Intronic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055047607 9:71946125-71946147 TTGAAGAAACCAAGTTAGTAGGG + Intronic
1055259764 9:74419856-74419878 TTGTAGATTCAGAGTCAGAAAGG + Intergenic
1059313998 9:113409064-113409086 TTGGAAAAACGGAGGCAGATGGG + Intronic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1060413904 9:123417597-123417619 TTAGAAGAACCGTGTCAGAAAGG - Intronic
1185811870 X:3118144-3118166 TTAGAGAAACAAAGACAGAAGGG + Intergenic
1186452102 X:9682647-9682669 TTGGATAAGGCGAGGCAGAAGGG + Intronic
1189841657 X:45085527-45085549 ATAGGGAAACTGAGTCAGAATGG + Intronic
1190335734 X:49260664-49260686 TCTGAGAAACCCAGTCAGAAAGG - Intronic
1190679334 X:52811466-52811488 TTGGTGACTCCGAGTGAGAAGGG + Intergenic
1193320733 X:80118450-80118472 TTTGGGAGACCGAGGCAGAAGGG + Intergenic
1194460543 X:94161985-94162007 TTGGAAAAACAGAATCACAAAGG - Intergenic
1195091394 X:101463081-101463103 ATGGAGAAAGAGAGACAGAATGG - Intronic
1199268051 X:145850184-145850206 TTGGGGAAACCGAGCCAAAGAGG + Intergenic
1199843857 X:151676618-151676640 TTGGAGAAGCCCAGAGAGAATGG + Exonic
1201757990 Y:17509681-17509703 TTGAATAAACCTATTCAGAAAGG + Intergenic
1201843565 Y:18396301-18396323 TTGAATAAACCTATTCAGAAAGG - Intergenic