ID: 927161593

View in Genome Browser
Species Human (GRCh38)
Location 2:20268011-20268033
Sequence CAGCACCCCTTGCCCCGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927161593 Original CRISPR CAGCACCCCTTGCCCCGCGG AGG (reversed) Intronic