ID: 927162607

View in Genome Browser
Species Human (GRCh38)
Location 2:20282108-20282130
Sequence CCAGCTGCACCGATAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927162602_927162607 10 Left 927162602 2:20282075-20282097 CCAAATAGTCCTATCCTCATGAA 0: 1
1: 0
2: 0
3: 7
4: 109
Right 927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 76
927162603_927162607 1 Left 927162603 2:20282084-20282106 CCTATCCTCATGAAGTAAAAGCT 0: 1
1: 0
2: 0
3: 14
4: 168
Right 927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 76
927162604_927162607 -4 Left 927162604 2:20282089-20282111 CCTCATGAAGTAAAAGCTGCCAG 0: 1
1: 1
2: 0
3: 14
4: 177
Right 927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927162607 Original CRISPR CCAGCTGCACCGATAGAACT GGG Intronic
904684113 1:32248427-32248449 CCAGCTGCACCGACTGAAGATGG + Exonic
906307098 1:44726323-44726345 CCATTTGCACCAATAGAACAAGG + Intergenic
915602991 1:156933994-156934016 CCAGCTGCAGAGACAGAGCTGGG - Intergenic
916551982 1:165858482-165858504 CCAGCTGCTCTGATAGGCCTGGG + Intronic
917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG + Intronic
918380327 1:183947171-183947193 CCACCTGCAATAATAGAACTAGG + Intronic
921069647 1:211648576-211648598 CCAGCTGCTCCCAGTGAACTTGG + Intergenic
923888448 1:238183737-238183759 GCAGCTGCACCAATAGAAAAGGG - Intergenic
924895150 1:248330143-248330165 CCAGTTGCACAGAAAGCACTTGG - Intergenic
1068626707 10:59256920-59256942 CCAGCAGCAACTATAGAATTAGG - Intronic
1071295394 10:84215705-84215727 AGAGCTGCACCCACAGAACTGGG - Exonic
1077183415 11:1226338-1226360 GCAGCTGCACCCCTAGATCTGGG - Intronic
1079771211 11:24461965-24461987 GCAGCTGCACCAATAGAAAAGGG - Intergenic
1082884053 11:58065802-58065824 TCAGCTGCTCAGAGAGAACTAGG + Intronic
1088640204 11:111865420-111865442 CCAGCTGGAGTGATAGAAGTAGG - Intronic
1092300318 12:7242333-7242355 GCAGCTGCACTGATAGAAAGGGG + Intergenic
1095039281 12:37423696-37423718 CCCCCTGCACCGGTAGAAGTCGG - Intergenic
1101851255 12:108404136-108404158 CCAGCACCACGGATAGCACTGGG - Intergenic
1102646634 12:114408077-114408099 GCCGCTGCACCTATAGGACTTGG + Exonic
1103944376 12:124517959-124517981 CCACCTCCAGCGACAGAACTGGG + Intronic
1109468946 13:62779328-62779350 GCAGCTGCACCAATAGAAAAGGG + Intergenic
1111012652 13:82331241-82331263 GCAGCTGCACCAATAGAAAAGGG + Intergenic
1118821799 14:69350657-69350679 CCAGCTGCAGGGATAGGGCTAGG - Intronic
1119785015 14:77306514-77306536 CCAGCTGCACCCACAGACTTTGG + Intronic
1122715317 14:103693446-103693468 CCAGCTGCACAGCTAAATCTAGG - Intergenic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1131008906 15:89001281-89001303 GCAGCTGCACCAATAGAAAAGGG + Intergenic
1136984285 16:35084653-35084675 CCAGCTGCACATCTAGAACAAGG - Intergenic
1149253280 17:54794744-54794766 GCAGCTGCACAGATAGAAAGGGG - Intergenic
1151378741 17:73710270-73710292 CCGGCTGCACCGCTGGAAGTGGG + Intergenic
1151665927 17:75545132-75545154 TCAGCTGCACAGACAGAACTTGG - Intronic
1153528696 18:6021744-6021766 CCCGCTGCACCAGGAGAACTGGG - Intronic
1155669300 18:28349596-28349618 GCAGCTGCACCAATAGAAAAGGG - Intergenic
1158906496 18:62018235-62018257 CCAGCTGCTCTGGTAGAGCTGGG + Intergenic
1160290435 18:77588690-77588712 CCAGCCACACCCATTGAACTGGG - Intergenic
1166422200 19:42646218-42646240 CCAGCTGCAAACATAGTACTGGG - Intronic
1166653238 19:44591293-44591315 GCAGCTGCACCAATAGAAAAGGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925335269 2:3094434-3094456 CCAGCTTAAGTGATAGAACTGGG + Intergenic
927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG + Intronic
928592670 2:32833585-32833607 CCAACCGTACCTATAGAACTTGG - Intergenic
931223505 2:60309385-60309407 CCATCTGCAGGGATGGAACTTGG + Intergenic
934032693 2:88062452-88062474 GCAGCTGCACCAATAGAAAAGGG - Intergenic
936155061 2:110041954-110041976 CCAGCTGAACCCAGAGAACATGG + Intergenic
936189621 2:110329460-110329482 CCAGCTGAACCCAGAGAACATGG - Intergenic
937271015 2:120652721-120652743 CCAGCTGTCCCCATAGAACACGG - Intergenic
938722823 2:134081432-134081454 CCAGATGCAGAGATGGAACTGGG - Intergenic
943525095 2:189006405-189006427 CCAGCTGGACCGACAGGACCAGG - Exonic
945881275 2:215327675-215327697 CCAGCTGCACCGGTAGTGCTTGG - Intronic
1171571035 20:26251730-26251752 CCCCCTGCACCGGTAGAAGTCGG - Intergenic
1178437916 21:32575773-32575795 ACAGCTGCATGGACAGAACTGGG + Intergenic
952556099 3:34532864-34532886 ACAGATGCAGAGATAGAACTGGG + Intergenic
955076695 3:55620656-55620678 ACAGCTGCACAGAGGGAACTGGG + Intronic
957996142 3:87692321-87692343 GCAGCTGCACTGATAGAAAACGG + Intergenic
960493089 3:118341185-118341207 CCAGCCTGACCCATAGAACTTGG - Intergenic
967721829 3:192824034-192824056 CCAGCTTCACCAAGAGAACACGG + Intronic
968904196 4:3444105-3444127 GCAGCTGCAGTGATAGGACTGGG - Exonic
972108511 4:35525246-35525268 CCAGGTGCACCAATTGAAATGGG + Intergenic
974729309 4:65841040-65841062 CCAGCTGCACTGACAGAAAGGGG - Intergenic
979108955 4:116725554-116725576 CCTGCTGCACCAACACAACTTGG - Intergenic
985076074 4:186216282-186216304 CCAGCTCCCTCAATAGAACTTGG - Intronic
985322783 4:188733492-188733514 CCAGCTGCACGGCAAGAACACGG - Intergenic
989730557 5:44642292-44642314 CCAGCTGCAGCTCTAGATCTGGG - Intergenic
994129182 5:96204811-96204833 CCAGCTGTACCTATAGAGGTTGG + Intergenic
996277620 5:121686590-121686612 GCAGCTGCACCAATAGAAAAGGG + Intergenic
1003858945 6:10304301-10304323 CCAGCAGCACCATGAGAACTCGG + Intergenic
1013586363 6:111582411-111582433 CCAGGTGCAGGGATAGATCTAGG - Intronic
1014534013 6:122595320-122595342 GCAGCTGCATTGATAGAACAGGG - Intronic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1031966907 7:128033049-128033071 CCCGCTGCCCCCAGAGAACTGGG + Intronic
1037010943 8:13841670-13841692 GCAGCTACACCAATAGAACAGGG + Intergenic
1042624995 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG + Intronic
1042762245 8:72283530-72283552 ACAGCTGCACCAATAGAAAAAGG + Intergenic
1045080851 8:98624305-98624327 ACAGCTACACTGATAGAGCTAGG - Intronic
1045672607 8:104573114-104573136 CCAGCAGCACCGATAGTAGTAGG + Intronic
1056012012 9:82342305-82342327 GCAGCTGCACCGATAGAAAGGGG - Intergenic
1188988582 X:36790146-36790168 GCAGCTGCACCAATAGAAAAGGG + Intergenic
1192998551 X:76538738-76538760 GCAGCTGCACCAATAGAAAATGG - Intergenic
1193936654 X:87631263-87631285 GCAGCTGCACCGATAGGAAAGGG - Intronic
1199332777 X:146581808-146581830 CCAGCTGCAGCAATAGCAGTGGG + Intergenic
1200375657 X:155777134-155777156 CCAGCTTGACCCAGAGAACTGGG - Exonic