ID: 927162735

View in Genome Browser
Species Human (GRCh38)
Location 2:20283747-20283769
Sequence AAACTACAGGCTATGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927162731_927162735 10 Left 927162731 2:20283714-20283736 CCACAAAATGAAGAGGTATTTTC 0: 1
1: 0
2: 2
3: 44
4: 313
Right 927162735 2:20283747-20283769 AAACTACAGGCTATGAAGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927162735 Original CRISPR AAACTACAGGCTATGAAGGA AGG Intronic
900851157 1:5144144-5144166 AAATTACAGAATATGAAAGATGG - Intergenic
906762671 1:48390391-48390413 ATACTAGAGGCTGGGAAGGATGG + Intronic
906954020 1:50357817-50357839 AATCAACTGGCCATGAAGGATGG - Intergenic
907415709 1:54312614-54312636 ATAGTAGAGGCTGTGAAGGAAGG - Intronic
907567398 1:55448590-55448612 AAACCATAGGCTATGAATGAGGG - Intergenic
908590349 1:65625579-65625601 AAACTACATGTTGTGAAAGAAGG + Intronic
909667806 1:78154922-78154944 AATTTATAGACTATGAAGGAAGG + Intergenic
910530856 1:88233913-88233935 AAACACAAAGCTATGAAGGATGG + Intergenic
912187948 1:107302990-107303012 AACCTACAGGGTAGGAAGGTAGG - Intronic
912889607 1:113514851-113514873 TAACTCCAGGATATGAAAGATGG + Intronic
913358795 1:117955302-117955324 AAGCTGAAGGCTATAAAGGAAGG - Exonic
915233707 1:154465150-154465172 AAGCTGCGGGCTCTGAAGGAAGG + Exonic
918303231 1:183222950-183222972 ACACTTTGGGCTATGAAGGAGGG - Intronic
919002397 1:191849316-191849338 ACAATAAAGACTATGAAGGAGGG + Intergenic
920693630 1:208165153-208165175 AAGCTCCAGGCTGAGAAGGAGGG - Intronic
920786144 1:209043309-209043331 AAACAAGAGGCTATGGAGGGAGG + Intergenic
923381407 1:233422836-233422858 TAACTACAGGCCCTGAAGCATGG - Intergenic
924109479 1:240683913-240683935 AAACTCAAGGCCAAGAAGGAAGG + Intergenic
924861949 1:247934340-247934362 ACACAACACGCTATGAACGAGGG + Exonic
924903319 1:248425600-248425622 AAATTTCAGGCCATGAGGGAAGG + Intergenic
924924543 1:248666204-248666226 AAATTTCAGGCCATGAGGGAAGG - Intergenic
1063454568 10:6174121-6174143 AAAATACAGGCTTTGGAGTAAGG - Intronic
1064597344 10:16959243-16959265 AAACCTCAGGCTATCAAGGAGGG + Intronic
1069888219 10:71637214-71637236 AAAGTACAGCCGAGGAAGGAGGG + Intronic
1070204379 10:74241984-74242006 AAACCAAAGGCTCAGAAGGAAGG - Intronic
1075671701 10:124267665-124267687 AATCCACAGGCTATTAAGGGAGG + Intergenic
1076784086 10:132740739-132740761 AAACTACAGGATAATAAAGAAGG + Intronic
1076799084 10:132812398-132812420 AAACTAGAGGCCCTGAGGGAGGG + Intronic
1080865208 11:36188242-36188264 AAACTACAAGTTTTGAAGGTAGG - Intronic
1082217356 11:49588037-49588059 AAACTACAGGGGATTAAAGATGG + Intergenic
1085608568 11:77925172-77925194 AAAGGACAGGCTAAGAAGAAAGG + Intronic
1085942257 11:81219124-81219146 CATCTCCAGTCTATGAAGGATGG - Intergenic
1087755341 11:102048885-102048907 AAACTACAGTCAATGCATGAAGG - Intronic
1089830893 11:121327083-121327105 GATCCACAGGCTATGAAGGTTGG - Intergenic
1090471875 11:126988387-126988409 ATCCTACAAGCTATGAAGGAGGG + Intronic
1090474544 11:127007677-127007699 GAGGTTCAGGCTATGAAGGAGGG - Intergenic
1090858292 11:130630894-130630916 AAACTACAGAGTAAGAAGTAGGG + Intergenic
1093437360 12:19150887-19150909 AGACTTCAGGCTGGGAAGGAGGG + Intronic
1093996258 12:25646146-25646168 AAACCCCAAGCTATGAGGGATGG + Intronic
1095790140 12:46157913-46157935 AAAACACAGGCTATGAAATAAGG + Intergenic
1097750208 12:63344376-63344398 ATACTCCAGCCTATGGAGGAGGG + Intergenic
1100236878 12:92670435-92670457 AGACTACAGGCTAGGAAGGAAGG - Intergenic
1103647239 12:122403992-122404014 AAACCACAGGGCATGAAGGCAGG + Intronic
1103865953 12:124052336-124052358 AAACGACAGGTTTTGAGGGATGG + Intronic
1105682001 13:22737648-22737670 ATACTAGAGGCTAGGAAGGGCGG + Intergenic
1108478865 13:50846713-50846735 AAACTACTTGATATGAAGCAAGG + Intergenic
1109319591 13:60793531-60793553 AGACTCCAGTCTATGAAAGATGG + Intergenic
1109479635 13:62932227-62932249 AAAAAACAGACTATGAAGGGAGG + Intergenic
1109851565 13:68072103-68072125 AAAATACAGGCAATAAAGCAAGG - Intergenic
1112227169 13:97551167-97551189 AATCTCCATGCTTTGAAGGAGGG + Intergenic
1114870319 14:26647828-26647850 AAACTAAAAGAAATGAAGGATGG - Intergenic
1120030774 14:79638151-79638173 AAACCACAGGCTAGAAAGGAGGG - Intronic
1125665107 15:41424212-41424234 GCACTACAGGCCATGAAGCAAGG + Intronic
1126014215 15:44334270-44334292 AAAGTACAGGAAATGAAGGGTGG - Intronic
1126051554 15:44690245-44690267 AATCCATAGGCTATGAAGGGTGG + Intronic
1128681739 15:69657459-69657481 ACACTGCAGGCTAGGGAGGATGG - Intergenic
1129021794 15:72526364-72526386 AAACTACAGACTAAGAGGCATGG - Intronic
1133832884 16:9340518-9340540 AGACTACAGGCTTTGAAGCCAGG - Intergenic
1133954603 16:10430602-10430624 AAATTCCAGGATATGAAAGATGG + Exonic
1134200501 16:12194441-12194463 AACATACAGGTTAGGAAGGAAGG - Intronic
1134459069 16:14416084-14416106 ACACAACAGGCAAGGAAGGAAGG + Intergenic
1138485238 16:57337516-57337538 ATACTACAGGCTAGGCAGGGTGG - Intergenic
1140071921 16:71657773-71657795 GAACTACTGGCAAAGAAGGAGGG + Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1146537041 17:33661572-33661594 AAACTTGAGGTTCTGAAGGAAGG - Intronic
1148008404 17:44453903-44453925 AAACTTCAGTATATGAAAGAGGG - Intronic
1148071327 17:44910548-44910570 AACCTACAGGCCCTGGAGGAGGG + Exonic
1152406235 17:80099566-80099588 CACCTGCAGGCTGTGAAGGAGGG + Exonic
1159329772 18:66977019-66977041 ACTCTGCAGGATATGAAGGAAGG - Intergenic
1165161913 19:33821243-33821265 AAACTAGAGGCTGTGTGGGAAGG - Intergenic
1165864062 19:38925379-38925401 GAACTACAGGCTACCAGGGAAGG - Intronic
925814828 2:7737237-7737259 AAACCACAGGCCATGAAAGAAGG + Intergenic
926914944 2:17882122-17882144 GTACTACAGGCAATGAAGGTAGG + Intronic
927067738 2:19490684-19490706 AGACTGCAGGCTTGGAAGGAGGG + Intergenic
927162735 2:20283747-20283769 AAACTACAGGCTATGAAGGAAGG + Intronic
928080437 2:28307757-28307779 AAACTACAGAATAAGATGGAAGG - Intronic
928233749 2:29522412-29522434 AAATTACGGGGAATGAAGGAAGG + Intronic
929251101 2:39756523-39756545 AAAATACAAGCTGTGAAGGAGGG + Intronic
929470068 2:42182832-42182854 AACCTACAAGCTAGGGAGGAAGG - Intronic
930688281 2:54331829-54331851 AAAATACAGGCTTTGGAAGAGGG - Intronic
931308885 2:61059533-61059555 AAACTACAGGCTGGGCAGGGTGG - Intergenic
933379989 2:81530245-81530267 AAAATTTAAGCTATGAAGGAAGG - Intergenic
934985588 2:98882496-98882518 AAATGAGAGTCTATGAAGGAAGG + Intronic
935933006 2:108150033-108150055 AAACTACAGGCAAAGCAAGAAGG + Intergenic
936065955 2:109332360-109332382 GAGCTACAGGCTGAGAAGGAAGG - Intronic
936075220 2:109397520-109397542 CAAGTACAGCCTAAGAAGGAAGG + Intronic
936656468 2:114493814-114493836 CAACTACAGGCCATGAACGATGG + Intronic
937246538 2:120497539-120497561 ACAATGCAGGCTGTGAAGGAAGG - Intergenic
938239237 2:129730341-129730363 AAACTCAAGGCTCTGATGGATGG - Intergenic
938987582 2:136593809-136593831 AAACTACAGACTATGCACAAAGG - Intergenic
939845532 2:147241686-147241708 AAACTACTGTGTTTGAAGGAAGG + Intergenic
944842492 2:203637746-203637768 AAAATAAAGGCTATGAGGAAAGG + Intergenic
945284929 2:208072658-208072680 AGACTACAGCCTATGCAGAAAGG - Intergenic
945471950 2:210237510-210237532 CAACTACAGGCCAAGGAGGAAGG + Intergenic
946017439 2:216615280-216615302 AAAATACAGGCTATGAGGAGTGG - Intergenic
946578530 2:221102518-221102540 AAGCTACAGGCTCTGAAGTCAGG + Intergenic
947521725 2:230850653-230850675 AAACAGCAGGCTAGGAAGAAAGG + Intergenic
1170353112 20:15464023-15464045 AAACTACAAGCTATGTGAGATGG - Intronic
1171284831 20:23928509-23928531 AAACCACAGTCTATGGGGGAGGG + Intergenic
1173516066 20:43666640-43666662 AAAATAAAGTCTATTAAGGAGGG + Intergenic
1173801814 20:45898856-45898878 GCACTACAGGCTATGAATGTGGG + Exonic
1174901283 20:54503849-54503871 AAACTGCAGCCTATGAAGATGGG + Intronic
1177227804 21:18280278-18280300 AAACTTCATCCTATGAAGGCCGG + Intronic
1178190725 21:30276853-30276875 AAAATACATTCTATGAAAGAAGG + Intergenic
1178613544 21:34109479-34109501 AAAATGCAGGCTGTGAATGATGG - Intronic
1179495382 21:41768213-41768235 CCGCTACAGGCTATGAAAGAAGG - Intergenic
950013173 3:9738044-9738066 AAACTACAGGGTACAAAGGAAGG - Intronic
950818367 3:15731473-15731495 AAACTACAGGCTGTGAGAAAGGG + Intronic
950825081 3:15810218-15810240 AAACCAGAGGCCATGTAGGATGG + Intronic
952027522 3:29100410-29100432 AAAGTCCAGGCTATGGGGGAAGG - Intergenic
955289694 3:57679815-57679837 AAAATACAGGCTGGGAAGGCGGG + Intronic
955935897 3:64102224-64102246 AAACTAAATGCTATAAAGTAGGG + Intronic
956447769 3:69342887-69342909 ACACTAGAGGCTAGGAAGGGTGG + Intronic
956852605 3:73244492-73244514 TAACAACATACTATGAAGGAAGG - Intergenic
957941752 3:87014767-87014789 ATACTACATACTCTGAAGGAGGG - Intergenic
957986989 3:87584979-87585001 TAACTACAGGCTATAAAATAAGG - Intergenic
958040994 3:88226363-88226385 ATACTAGAGGCTGAGAAGGATGG - Intergenic
958193260 3:90210400-90210422 TAAATACAGACTATGAAAGATGG + Intergenic
959449081 3:106477378-106477400 ATACTAAAGGATATAAAGGAAGG - Intergenic
959452582 3:106522214-106522236 AGGCTACAGCCTAGGAAGGAAGG - Intergenic
959466489 3:106693723-106693745 AAAATACAAGATATGAATGAGGG - Intergenic
960891836 3:122457160-122457182 AAAGTACAGACTATGATGAAAGG - Intronic
961658476 3:128456127-128456149 AAAATACAGGCTATGAATCAGGG - Intergenic
962414492 3:135169628-135169650 AAACTGAAGGCTCTGATGGAGGG + Intronic
963120374 3:141771432-141771454 ACACTAAAGTCTAGGAAGGATGG + Intergenic
963226280 3:142865614-142865636 AAACAACATCCTGTGAAGGATGG + Intronic
965736953 3:171830696-171830718 ATACTAGAGGCTGGGAAGGATGG + Intergenic
967167432 3:186794618-186794640 ATAATACATGCTATGGAGGAGGG + Intronic
967257855 3:187611751-187611773 AAACTACAGCTTCTCAAGGAAGG - Intergenic
967822352 3:193849890-193849912 AGACTACCAGCTATGAAGAAAGG + Intergenic
968057886 3:195706754-195706776 TAACTACAGGCTCAGAAGTAGGG + Intergenic
971894452 4:32573876-32573898 ATACTAGAGGCTGAGAAGGATGG - Intergenic
972722893 4:41718419-41718441 AAACATCAGGCTATAAAGGAAGG - Intergenic
973153469 4:46916849-46916871 ACACTACAAACTATGAGGGAAGG + Intergenic
974796621 4:66760360-66760382 AAATTACATTCTATGAAGAAAGG + Intergenic
976046177 4:80950628-80950650 AAACATGAGGCTGTGAAGGAAGG + Intronic
976493707 4:85701255-85701277 AAACAAAAGGCTATGAGGCAAGG - Intronic
977457419 4:97279110-97279132 AAAGTACAGGTAATGAGGGAAGG - Intronic
978943046 4:114460456-114460478 AAACTACAGGGCTTGAAGTAGGG - Intergenic
979010957 4:115367030-115367052 AGAATACTGGCTTTGAAGGATGG - Intergenic
979499635 4:121424989-121425011 AAACTAAAAGCTAGGAAGGTAGG + Intergenic
980562744 4:134499175-134499197 AAACTCCAGGCTATTTAAGAAGG - Intergenic
981465613 4:145068044-145068066 AATCTACAAGCTAAGAATGAAGG + Intronic
981785755 4:148477723-148477745 AAGATAAATGCTATGAAGGAGGG - Intergenic
981867240 4:149437622-149437644 ATACTCCAGGCTCTGCAGGAGGG - Intergenic
982427364 4:155280894-155280916 ATACTAGAGGCTAGAAAGGATGG - Intergenic
982604714 4:157499964-157499986 AATCTACAGGCTGTGAACAAAGG + Intergenic
986618953 5:9650401-9650423 ACACTCCCGGCTATGTAGGACGG + Intronic
987483554 5:18492309-18492331 TAACTTCAGGTTATGAAGGTAGG + Intergenic
988062212 5:26185900-26185922 AGGCTACAGGCAATAAAGGAGGG + Intergenic
990356107 5:54967656-54967678 AAACTACAGGGCATGGAGCAAGG + Intergenic
990680005 5:58232013-58232035 AAAAGATAGGATATGAAGGAAGG - Intergenic
992694389 5:79271317-79271339 AAACTACAGGCTGAGCATGATGG - Intronic
994758862 5:103828324-103828346 GACCTACAGCCTATGAAGGAAGG - Intergenic
994814086 5:104561666-104561688 AAAGCACAAACTATGAAGGAGGG - Intergenic
995083138 5:108077374-108077396 AAATTATAGGCTAGGAATGATGG + Intronic
995103083 5:108339598-108339620 AAACTACAGACTATGTATGTGGG + Intronic
995753490 5:115477447-115477469 CAAGTACAGTATATGAAGGATGG + Intergenic
997416959 5:133736359-133736381 GAATCACAGGCTCTGAAGGAGGG + Intergenic
997508800 5:134438937-134438959 AAACTCCTGGCCAAGAAGGATGG - Intergenic
998322396 5:141245105-141245127 AGACTACAGGCTCTGGAGGGTGG + Intergenic
1001098021 5:168790907-168790929 AAAGTACAGGCTTTGGAGGCAGG - Intronic
1002394020 5:178939567-178939589 TAACTACAGGCCTTGAAGGAAGG - Intergenic
1003737294 6:8890979-8891001 AAAATACTGTCTATGAAGGTGGG + Intergenic
1005338986 6:24825426-24825448 AAACTGGAGGGTAAGAAGGAAGG + Exonic
1005794066 6:29338795-29338817 AAACAAAAGACTATGAAGGTGGG + Intergenic
1005891740 6:30146072-30146094 AAACTGCAGGCTCTGCAGGTGGG + Exonic
1006896885 6:37476993-37477015 AAACCACAAGCAATGAAGGCAGG - Intronic
1010077738 6:71820452-71820474 AAAATACATGATATGAATGAAGG - Intergenic
1014873602 6:126627961-126627983 AAAATAAAGGCTATAAATGAAGG - Intergenic
1015351984 6:132230897-132230919 AAACTACAGTCTTTGATGGCAGG + Intergenic
1016896215 6:149055912-149055934 CAACAACAGGCTATAAATGAAGG - Intronic
1021289263 7:18823050-18823072 AAAACACAGGCTATCAAAGAGGG + Intronic
1022941589 7:35246356-35246378 AAGCTACAGTCTTGGAAGGATGG - Intronic
1023158810 7:37277980-37278002 AAACTGCAGGCTTTGAGGCAAGG - Intronic
1023165462 7:37338971-37338993 AAACTCCAGGCACTGATGGAGGG + Intronic
1024632949 7:51264171-51264193 AAACTGCAGGCAAGGAAGGATGG + Intronic
1024633662 7:51269190-51269212 AAACTGCAGGGAAGGAAGGACGG + Intronic
1025844329 7:65182673-65182695 AAAGGACAGGCTAAGAAGAAAGG - Intergenic
1025894657 7:65689007-65689029 AAAGGACAGGCTAAGAAGAAAGG - Intergenic
1026072956 7:67139026-67139048 TAACTACAGGTTTTGAAGTAAGG - Intronic
1026703926 7:72673190-72673212 TAACTACAGGTTTTGAAGTAAGG + Intronic
1027481368 7:78701679-78701701 AAAGTAAAGTTTATGAAGGAAGG - Intronic
1028884641 7:95917774-95917796 CACCTACCAGCTATGAAGGACGG - Intronic
1030876801 7:114823442-114823464 AAAGCCCAGGCTATGCAGGATGG - Intergenic
1032576889 7:133063931-133063953 AAACTTGAGGCTAAGAGGGATGG - Intronic
1033317785 7:140312679-140312701 AGATTACAGGCAATGAAAGAAGG - Intronic
1036635107 8:10544592-10544614 ACACAAAAGGCTATAAAGGAAGG - Intronic
1040299961 8:46182875-46182897 AAGCTTCAGGCTTTGAAGCAGGG - Intergenic
1040301937 8:46192543-46192565 AAGCTTCAGGCTTTGAAGCAGGG + Intergenic
1040303436 8:46199972-46199994 AAACTCCAGGCTTTGGAGCAGGG + Intergenic
1040305158 8:46208227-46208249 AAACTTCAGGCTTTGAAGCAGGG + Intergenic
1040308095 8:46222681-46222703 AAACTTCAGGTTTTGAAGCACGG + Intergenic
1040314348 8:46253116-46253138 AAGCTCCAGGCTTTGGAGGAAGG + Intergenic
1040314517 8:46253984-46254006 AAGCTTCAGGTTATGAAGCAAGG + Intergenic
1040752860 8:50731687-50731709 AAACTACATGCTATCAAAAATGG + Intronic
1042185940 8:66136214-66136236 AGTCTCCAGGCTCTGAAGGAAGG - Intronic
1042732889 8:71956594-71956616 AAATTAAAGGTTATGGAGGAAGG + Intronic
1043477771 8:80621951-80621973 AAAGTACAGGCAATAGAGGATGG + Intergenic
1044831373 8:96253294-96253316 GGACTAGAGGCTATTAAGGAAGG + Intronic
1046101184 8:109615964-109615986 AAATTACAGGGAATAAAGGAAGG - Intronic
1046154111 8:110264743-110264765 AAAGTATAGGCTATAAAGAATGG + Intergenic
1046222924 8:111238916-111238938 AAACCTCAAGCCATGAAGGAAGG + Intergenic
1046978150 8:120306567-120306589 AAACTAAAGGATCTGTAGGAAGG + Intronic
1046995467 8:120516054-120516076 AAACTACAGGAGATGGAAGAGGG - Exonic
1047152485 8:122279913-122279935 ATACTAGAGGCTGGGAAGGATGG + Intergenic
1052365267 9:27605443-27605465 AAACTACAGGCCATGTAATAAGG - Intergenic
1056925680 9:90832553-90832575 AAAATAGAGGTTAGGAAGGAAGG - Intronic
1059553074 9:115250062-115250084 AAAACACAGGCTATGAAAAAAGG - Intronic
1189224095 X:39398286-39398308 AAAATAGAGGAAATGAAGGACGG - Intergenic
1191183543 X:57586692-57586714 AATCTGCAGTCTCTGAAGGAGGG - Intergenic
1191941036 X:66482222-66482244 AACCAACAGGCTAGGAAGGGAGG - Intergenic
1192286508 X:69743878-69743900 AAACTTCATGCTATGTGGGATGG + Intronic
1193057532 X:77169115-77169137 AAAGTTCAGGCTATGGGGGAAGG - Intergenic
1194015838 X:88619495-88619517 AAACCACAGGCAATTAAAGATGG + Intergenic
1194521273 X:94921120-94921142 AGTCAACAGGCTAAGAAGGAAGG + Intergenic
1197539705 X:127742936-127742958 AAATTACAGACTAGGAAGGGTGG - Intergenic
1201350975 Y:13040953-13040975 AAATTAGAGGCTATGAATGCTGG + Intergenic