ID: 927168992

View in Genome Browser
Species Human (GRCh38)
Location 2:20352375-20352397
Sequence GGTGATGGGGAGCAATGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 1, 1: 1, 2: 5, 3: 76, 4: 690}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927168992 Original CRISPR GGTGATGGGGAGCAATGAGA TGG (reversed) Intergenic
900283843 1:1890303-1890325 GGGGAAGGGGAACAATGAAATGG - Intronic
900300232 1:1973426-1973448 GCTGAAGGGAAGGAATGAGATGG + Intronic
900302367 1:1984403-1984425 GGTGCTGCTGAGCAGTGAGAGGG + Intronic
900394434 1:2447402-2447424 GGGGAGGGGGAGCCCTGAGAAGG - Intronic
900563268 1:3319207-3319229 AGGGATGGGGAGCTAGGAGAGGG + Intronic
900959888 1:5912170-5912192 GGGGCAGGGGAGCAATGGGATGG + Intronic
900966169 1:5960270-5960292 GGAGAGGGTGAGAAATGAGAAGG - Intronic
901629672 1:10641986-10642008 GGTGATGGACAGCGGTGAGAAGG + Intronic
901932911 1:12608411-12608433 GGTGCTGGGGAGCAGGGAGGAGG - Intronic
902064060 1:13669634-13669656 GGTGGTGGGGGGCAAGGGGAGGG - Intergenic
902128515 1:14238312-14238334 GGTGATGGGACCAAATGAGAAGG + Intergenic
902774378 1:18665287-18665309 TGTGAAGGTGAGCAATGAGGCGG + Intronic
903050200 1:20594917-20594939 GGTGATGGGCAGGGAAGAGAAGG + Intronic
903194115 1:21672252-21672274 AGTGATAGGGAGCACAGAGATGG - Intergenic
903277870 1:22233160-22233182 GGTGATGGGAAGAACTCAGACGG - Intergenic
903763152 1:25713241-25713263 GGGGGTGGGGAACAAGGAGATGG + Intronic
903800945 1:25967748-25967770 TGTGATGGGGAACAGGGAGATGG + Intronic
904387656 1:30155236-30155258 GGTGATGGGGGGCTAGGGGAGGG - Intergenic
905259586 1:36708034-36708056 TGTGATGGGGAGAACTGAGAAGG - Intergenic
905806828 1:40883543-40883565 GGGCATGGGGAGGAAAGAGATGG - Intergenic
905899002 1:41568280-41568302 GGTGATGGAGAGAAGTGAGGGGG + Intronic
907107271 1:51895110-51895132 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
907303553 1:53502263-53502285 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907303576 1:53502343-53502365 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907303604 1:53502423-53502445 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907303632 1:53502503-53502525 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907601620 1:55776897-55776919 GGAGATGGTTGGCAATGAGATGG + Intergenic
907865767 1:58397734-58397756 GGTGGTGGGGAGCAATAAAGGGG - Intronic
908251268 1:62267864-62267886 GCTTATGGGTAACAATGAGAAGG + Intronic
908483579 1:64568514-64568536 GGAGATGGGGAGCTATCAGGTGG - Intronic
908593416 1:65657930-65657952 GGGGATGGGGGGCTAGGAGAGGG + Intergenic
909297406 1:73968265-73968287 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
909659321 1:78064582-78064604 GGGGATGGGAAACAATAAGAGGG + Intronic
910322050 1:85957190-85957212 GGGGATGGGGTGCAAGGGGAGGG + Intronic
910549851 1:88463212-88463234 TGTGATGGGGAGAAAGGAGGAGG - Intergenic
911805325 1:102200179-102200201 GGGGCTGGGGTGCAATGATATGG - Intergenic
913131631 1:115842827-115842849 GGTGTTGGGGAGTCATGACAGGG + Exonic
913452164 1:118999814-118999836 GGAGATGGGGAGGAAAGAGAGGG + Intergenic
914814532 1:151053806-151053828 GGAGATAGGGAGGAATTAGAAGG - Intronic
914901358 1:151712772-151712794 AGAGATGGGGAGCAAGGAGAGGG + Intronic
915024158 1:152811585-152811607 GGTGTTCTGGAGAAATGAGATGG + Intronic
915227043 1:154419001-154419023 GGTGGTGGGGAGCCCAGAGAAGG + Intronic
915320086 1:155051627-155051649 GGCGATGGGGTGAAAAGAGAAGG + Intronic
915997664 1:160580627-160580649 TGTTTTGGGGAGTAATGAGAAGG + Intergenic
916731383 1:167570148-167570170 GGGGATGGGGGGCAAGGTGAGGG - Intergenic
917508582 1:175650838-175650860 GGAGATGGGTAGTAATGAGGTGG - Intronic
917508614 1:175650945-175650967 GGTGGGGGGGAGTAATGAGATGG - Intronic
917508625 1:175650984-175651006 GGGGAGGGGTAGTAATGAGATGG - Intronic
917508651 1:175651069-175651091 GGTGGGGGGGAGTAATGAGATGG - Intronic
918066945 1:181107846-181107868 GGTGATGGGAAGATATGAAAGGG + Intergenic
918371039 1:183861883-183861905 TTTGATGGGAAGCTATGAGAGGG + Intronic
918678617 1:187322709-187322731 GGGGTTGGGGAGCAAGGGGAAGG + Intergenic
919140925 1:193570881-193570903 GGGGGTGGGGGGCAAAGAGAGGG - Intergenic
919780019 1:201215678-201215700 GGTGGTGGGCAGCAGTGACAGGG + Exonic
919989115 1:202696910-202696932 GGTGATGGGGAGGAAAGGTATGG - Intronic
920051947 1:203169559-203169581 GGTGATGAGTAGAGATGAGAAGG + Intronic
920507977 1:206530551-206530573 GGGGATGTGGGGGAATGAGAAGG - Intronic
920701919 1:208224361-208224383 GGGGGTGGGGAGCAGGGAGAGGG + Intronic
921948102 1:220902109-220902131 GGTGATGGTGAGTAATCAGGAGG + Intergenic
922559056 1:226554804-226554826 GGTGAAAGGGAGCAAAGAAATGG - Intronic
922789856 1:228305627-228305649 GGTGATGGGAGGCAGTGGGAGGG - Intronic
923051774 1:230395074-230395096 GGGGATGGGGAGGAGTGTGAGGG - Intronic
923051790 1:230395119-230395141 GGGGATGGGGAGGAGTGTGAGGG - Intronic
923126453 1:231039005-231039027 GGTGATGGGGGCCAGTAAGATGG + Intronic
924265017 1:242273067-242273089 GGGGATGGGGGGCAAGGGGAGGG - Intronic
1062987566 10:1783471-1783493 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
1063015200 10:2070328-2070350 GGTGGTGGCGAGCAATTAGGAGG - Intergenic
1063441679 10:6078022-6078044 GGTCTTCGGGAGCAATGATAAGG + Intergenic
1063717828 10:8546171-8546193 AGTAATGGGGAACAATGAAAGGG - Intergenic
1064575234 10:16738850-16738872 GGGGGTGGGGGGCAAGGAGAGGG - Intronic
1065503343 10:26403297-26403319 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
1065592414 10:27278803-27278825 GGTGGTGGTGAGGAATGAGCAGG + Intergenic
1065657935 10:27971558-27971580 GGTGGTGGTGAGGAATGAGCAGG - Intronic
1065735389 10:28746749-28746771 GGTGATGGGGGGTAAGGGGAGGG - Intergenic
1066559493 10:36653753-36653775 GGAGCTGGGGAGCAAGGAAATGG - Intergenic
1066719792 10:38325423-38325445 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1068063846 10:52103398-52103420 GCTGAGGGGGAGGAAGGAGAGGG - Intronic
1068610512 10:59055065-59055087 GGCGATGGGGCCAAATGAGAAGG - Intergenic
1068936407 10:62639604-62639626 GGTGATGGGGGGCTGTGAGTAGG - Intronic
1070096355 10:73341065-73341087 TGAGATGGGGAGGAATTAGAAGG + Intronic
1070150508 10:73802192-73802214 GGAGGTGGGGAGGAATGAGAGGG - Exonic
1070623121 10:78029260-78029282 AGAGATGGGGTGCAATGGGAAGG - Intronic
1070734818 10:78856185-78856207 GGGGATGGGGAGAAGTGAGTGGG + Intergenic
1070924646 10:80211130-80211152 GGGCACGAGGAGCAATGAGATGG - Intergenic
1071521454 10:86333829-86333851 GCTGAGGGGGAGGAATAAGAGGG + Intronic
1072083073 10:92052772-92052794 GGTGCTGGGGAGGATTAAGAGGG + Intronic
1072396972 10:95053765-95053787 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1073632716 10:105164538-105164560 GGTAATGGGGTATAATGAGAAGG + Intronic
1074018331 10:109558680-109558702 AGGGATGGGGAGCAAGGAGGAGG + Intergenic
1074485544 10:113874350-113874372 GGTGGTGGGGAGGAGTGGGAAGG - Intronic
1074676800 10:115860353-115860375 TGTGATGGTGAGCAAAGGGAAGG - Intronic
1074890231 10:117729815-117729837 GGGGTTGGGGAGCAAGGGGAGGG - Intergenic
1075205390 10:120443489-120443511 GGGGTTGGGGAGCAAGGGGAGGG + Intergenic
1075523910 10:123166169-123166191 GGTGAGGGAAACCAATGAGAAGG - Exonic
1075661573 10:124200554-124200576 AATGATGGGGAGGAAAGAGAAGG + Intergenic
1075906309 10:126084753-126084775 GGGGATGGGGAGGGTTGAGAGGG - Intronic
1075939675 10:126379544-126379566 GGGGATGGGGAGCTAGGGGAGGG + Intronic
1076164026 10:128267913-128267935 GGTGGTGGGGAGCAAGGAACAGG + Intergenic
1076258994 10:129050837-129050859 GGTGATGGGGAGCAGGAAGCTGG + Intergenic
1076441451 10:130483838-130483860 GGTGATGGGGAGTAATGGGCTGG + Intergenic
1076462666 10:130657105-130657127 GGTGCTGGGTAGCTGTGAGAAGG + Intergenic
1076835099 10:133017002-133017024 GGTGACGGGGAGCATGGTGATGG - Intergenic
1076840950 10:133044899-133044921 GGAGCTGGGGAGCAGTGAGCCGG - Intergenic
1077501386 11:2911195-2911217 GGAAATGGGGAGAAAAGAGAGGG + Intronic
1078124266 11:8544151-8544173 GGGGATGGGGGGCTATGGGAGGG - Intronic
1078887895 11:15523649-15523671 GGCGATGGGATGCAGTGAGAGGG - Intergenic
1079267617 11:18949322-18949344 GGTGGTGGGGATCAAGGGGAGGG + Intergenic
1079278294 11:19062913-19062935 GGGGGTGGGGAGCTAGGAGAGGG - Intergenic
1079613476 11:22462090-22462112 GATGATGAGGAGAAATGGGAAGG - Intergenic
1080221439 11:29910057-29910079 GGTGGTGGGGGTCAAGGAGAGGG + Intergenic
1080303029 11:30805916-30805938 GGGGATGGGGGGCAAAGGGAGGG - Intergenic
1080330475 11:31131264-31131286 GGTGATTGGGGGAAATGAGAAGG + Intronic
1081431563 11:42982283-42982305 AGGGGTGGGGAGCAATGGGAAGG + Intergenic
1082041636 11:47690387-47690409 GGTGATGGTGAGCAAGTAAACGG + Exonic
1082269560 11:50155258-50155280 GGGGATGGGGAGGAAGGGGAAGG - Intergenic
1082629406 11:55524086-55524108 GGGGGTGAGGAGCAATGGGAGGG - Intergenic
1083043723 11:59713192-59713214 GGAGATGGAGATCAATGAGAGGG + Exonic
1084582941 11:70035678-70035700 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1085051238 11:73381361-73381383 TGTGAGGAGGAGCAGTGAGAGGG + Intronic
1085313678 11:75530872-75530894 GGTGGAGGGGAGCCATGGGAGGG + Intergenic
1085321402 11:75576339-75576361 GGAGATGGTGAGAACTGAGAGGG - Intergenic
1085909425 11:80803768-80803790 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
1085919082 11:80930190-80930212 GGTGATGGTGATGAATGACAGGG - Intergenic
1086089694 11:82993139-82993161 GGTGATGGAAAGAAATGTGAAGG - Intronic
1086505603 11:87500598-87500620 GGTGTTTGGGGGCTATGAGAGGG + Intergenic
1086780179 11:90894237-90894259 GGGGGTGGGGAGCAAGGTGAGGG - Intergenic
1087199787 11:95333831-95333853 GGTGATGGGAAGCCATTGGAAGG + Intergenic
1087273492 11:96137273-96137295 GGTTCTGGGGAGAAATGAGGAGG + Intronic
1087706428 11:101497845-101497867 GGGGGTGGGGGGCAATGGGAGGG - Intronic
1088357093 11:108955693-108955715 GGAGTTGGGGGGCAAGGAGAGGG + Intergenic
1088393478 11:109341851-109341873 GGGGGTGGGGAGCAAGGAGAGGG - Intergenic
1088763037 11:112950075-112950097 GGAAATGGGGAGCCATGACAGGG + Intergenic
1089083960 11:115801021-115801043 GGTGGTGGGGAGCAGAGAGAGGG + Intergenic
1089794338 11:120967927-120967949 GGTGATGGAGAGAAATGTGTAGG - Intronic
1089980141 11:122765491-122765513 GGTGAAGGGGAACAAAGAGTTGG + Intronic
1090085874 11:123650618-123650640 GGTGTTGGGGAGAGATGGGACGG + Intronic
1090414092 11:126528837-126528859 GGTGAGGGGCAGCATGGAGAGGG + Intronic
1090657653 11:128858177-128858199 AGGGATGGGGAGGGATGAGAAGG + Intronic
1090662602 11:128892326-128892348 AGAGAAGGGGAGCAATGACAAGG - Intronic
1091382098 12:68268-68290 GTTGAAAGGGAGCAATGACATGG + Intronic
1091689214 12:2584324-2584346 GGTGATGGGGAGGAAGGGGAGGG + Intronic
1091804115 12:3343659-3343681 AGTGATGGGGAGCAAGGGGTGGG + Intergenic
1092014745 12:5149373-5149395 GGTGCTGGGGAGTTAGGAGATGG + Intergenic
1093252252 12:16821115-16821137 GGAGGTGGGGAGCAAGGAGAGGG - Intergenic
1093502852 12:19832286-19832308 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1093780229 12:23127112-23127134 GGTGCTGGGGAGTAATGTAAAGG - Intergenic
1094274374 12:28654616-28654638 GGGGATGGGGAGTAAGGGGAGGG - Intergenic
1094310661 12:29077222-29077244 GGTGTTGGGGAGCTAGGGGAGGG + Intergenic
1095878303 12:47105553-47105575 GGTCATGGGGACCTATGAAAAGG + Intronic
1096528932 12:52231426-52231448 GGAGATGGGGACGGATGAGAGGG + Intergenic
1096542048 12:52313404-52313426 GGTGAAGGGGAGGAATGAAGAGG + Intergenic
1096875119 12:54623367-54623389 GGTGAAGGGGAGCAGTGACCTGG - Intergenic
1097427960 12:59470832-59470854 GGGGACGGGGGGCAAGGAGAGGG - Intergenic
1097708561 12:62894125-62894147 TTTGATGGGGTTCAATGAGATGG - Intronic
1098230342 12:68366635-68366657 TGAGATGGGAAACAATGAGACGG - Intergenic
1098439315 12:70501318-70501340 GGGGATGGGGAGCAAGGGAAGGG - Intergenic
1098785224 12:74745075-74745097 GGTGGTGGGGGGCTAGGAGAGGG - Intergenic
1099052907 12:77803268-77803290 GGGGATGGGGGGCTAGGAGAGGG - Intergenic
1099238403 12:80110394-80110416 GGTGATGGGGAGCAAGGGGAGGG - Intergenic
1099549645 12:84026891-84026913 GGGGGTGGGGAGTAATGGGATGG + Intergenic
1100129520 12:91474192-91474214 GGGGATGGGAAGCAAGGAGAGGG + Intergenic
1100412766 12:94338669-94338691 GGTGATAGGGAGAAATCAGAGGG + Intronic
1100565209 12:95789386-95789408 GGTGAGGGGGAGAGATGTGAGGG - Intronic
1100740639 12:97587717-97587739 GGGGATGGGGAGCAAGGGAAGGG + Intergenic
1100764848 12:97852330-97852352 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1100788437 12:98103971-98103993 GATGCTGGGGAGCAAAGAAAGGG + Intergenic
1101000865 12:100356230-100356252 GGGGTTGGGGGGCAAGGAGAGGG + Intergenic
1101165613 12:102028646-102028668 GGTGAGGGGAAGCAATGCGTGGG + Intronic
1101388935 12:104282630-104282652 TGTGAAGGAGAGCAATGAAATGG + Intronic
1101392029 12:104309974-104309996 GGTGCGGTGGAGCAATGTGAAGG - Intronic
1101955841 12:109212022-109212044 TGGGATGGGGAACAAGGAGATGG - Intronic
1102245500 12:111353281-111353303 GGGGCTGGAGAGCAACGAGAAGG + Intergenic
1102533029 12:113560826-113560848 GGTGATGGAGAGGAAGGAGATGG - Intergenic
1104026953 12:125034523-125034545 GGGGATGGAGAGCAGTGAGAGGG - Intergenic
1104691605 12:130830251-130830273 GGCGCTGGGGAGCATTGAGATGG - Intronic
1105015325 12:132783307-132783329 GGCCATGGGGAGGAATGAGAGGG - Intronic
1105250043 13:18690431-18690453 GGAGATGGGATGCAGTGAGAAGG + Intergenic
1105430328 13:20331248-20331270 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1106376816 13:29197210-29197232 GGGGATGGGGGGCAAGGGGAGGG - Intronic
1106604392 13:31214035-31214057 GGGGATGGGGAGGGATTAGAAGG + Intronic
1107430953 13:40339726-40339748 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1108384404 13:49885680-49885702 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1108546215 13:51497334-51497356 AGTGAGGAGGAGCAAGGAGAGGG - Intergenic
1108833937 13:54516790-54516812 AGTAATGGGGAGCTCTGAGAGGG + Intergenic
1109282798 13:60376450-60376472 GGGGATGGGGGGCTAGGAGAGGG + Intergenic
1109984758 13:69965463-69965485 GGAGAAGGGGAGAAATGAGGGGG - Intronic
1111073184 13:83196898-83196920 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1111340509 13:86879746-86879768 GATGATGGGAAATAATGAGAGGG - Intergenic
1111364537 13:87224696-87224718 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1111404857 13:87790721-87790743 GGTGGTGGGGGGCAAGGGGAGGG - Intergenic
1111704505 13:91731674-91731696 CGGGGTGGGGAGCAAGGAGAGGG - Intronic
1111956189 13:94761211-94761233 GGAGATGGGGAGAAAGGGGAAGG - Intergenic
1112082596 13:95990865-95990887 GGGGGTGGGGAGCTAGGAGAGGG - Intronic
1112375811 13:98839663-98839685 GGTGATGATTACCAATGAGATGG + Intronic
1112752341 13:102596357-102596379 GGTGAGGGGGAGCAATAGGGTGG - Intergenic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1115359297 14:32483918-32483940 GGGGATGGGGGGCAAGGTGAGGG - Intronic
1115435740 14:33371040-33371062 AATGATGTGGAGCAAAGAGAGGG + Intronic
1115702144 14:35964120-35964142 AGAGATGGGGAGAAAAGAGAAGG - Intergenic
1115871906 14:37814095-37814117 TGTGATGGGAAGCCATCAGAGGG - Intronic
1116331851 14:43606476-43606498 GGGGCTGGGGGGCAAGGAGAGGG + Intergenic
1116337410 14:43675089-43675111 GGGGATGGGGGGCTATGGGAGGG - Intergenic
1116498668 14:45593665-45593687 TGGGGTGGGGAGCAAGGAGAGGG + Intergenic
1116752961 14:48909916-48909938 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1116832865 14:49739559-49739581 GGTGATGGGGAACATAGAGTAGG + Intronic
1116953672 14:50901054-50901076 GGGGATGGGGAGAAATGAATGGG + Intronic
1116975551 14:51111699-51111721 GGGGATAGGGGGCAAGGAGAGGG + Intergenic
1116999840 14:51361269-51361291 TGTGAGGTGGAGCAAGGAGATGG + Intergenic
1118086479 14:62423682-62423704 GGGGATGGGGGGCAAGGAGGGGG + Intergenic
1119434103 14:74586755-74586777 GGAGATGGAGAACAATGGGAAGG - Intronic
1120616854 14:86717204-86717226 GGGGCTGGGGAGCTAGGAGAGGG + Intergenic
1120636053 14:86952300-86952322 GGGGATGGGGAGCAAGGGGAGGG + Intergenic
1121540710 14:94723930-94723952 GATGATGTGGAGCAATGGGTCGG + Intergenic
1121822520 14:96982954-96982976 GGTGATGGGAAACACTGAGCTGG + Intergenic
1122122576 14:99562260-99562282 GGTGATGGGCAGAGATGAAATGG - Intronic
1122401319 14:101469210-101469232 GGTGAGGGGGAGCATTGTGCTGG + Intergenic
1122434083 14:101680888-101680910 GGGGCTGGGGAGCAAGGGGAGGG - Intergenic
1124494243 15:30176616-30176638 GGAGGAGGGGAGCAATGAGGGGG + Intergenic
1124749327 15:32362029-32362051 GGAGGAGGGGAGCAATGAGGGGG - Intergenic
1125049000 15:35275551-35275573 GGGGGTGGGGAGCAAGGAGAGGG + Intronic
1125084547 15:35714813-35714835 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1126293363 15:47108593-47108615 GGGGATGTGGAGCAAGGGGAGGG - Intergenic
1126651669 15:50929051-50929073 CTTGATTAGGAGCAATGAGATGG - Exonic
1126711274 15:51459303-51459325 GGTGATGGGAAGGAAAGAAAAGG + Intronic
1127128252 15:55834770-55834792 GGTGATGTGGAGGCTTGAGAAGG - Intronic
1127760354 15:62133516-62133538 AGGGGTGGGGAGCAAGGAGAGGG - Intergenic
1127940822 15:63694023-63694045 GGAGAAGGGGAGCAAGAAGACGG - Exonic
1128194957 15:65744551-65744573 GGTGATGGGGAGGACTGGGCAGG - Intronic
1128308381 15:66614921-66614943 ACAGATGGGGAGGAATGAGAGGG + Intronic
1130108820 15:80948715-80948737 GGCGATGGGGAGCCATGGAACGG + Intronic
1130583151 15:85156428-85156450 GGGGATGGGAAGAAATGGGAAGG - Intergenic
1130771474 15:86928241-86928263 TGTGATGCAGAGCAAAGAGAGGG + Intronic
1131050491 15:89344323-89344345 GTGGAGGGGGAGCAATGAGAGGG - Intergenic
1131614377 15:93999155-93999177 CGTGAAGGGGAGAACTGAGAGGG + Intergenic
1132043783 15:98547775-98547797 GGGGATGGGGGGGAATGCGAGGG - Intergenic
1133422333 16:5656932-5656954 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1133659251 16:7899805-7899827 GGTGAGGGTGAGTAATGGGATGG + Intergenic
1133885744 16:9825997-9826019 GGAGAGGGGGAGGAATGAGAGGG + Intronic
1134128060 16:11629972-11629994 GGTGTTGGGGAGGGAAGAGAAGG + Intronic
1134569243 16:15277514-15277536 GGAGATGGGGAGCGAGAAGATGG - Intergenic
1134733134 16:16478531-16478553 GGAGATGGGGAGCGAGAAGATGG + Intergenic
1134934305 16:18233442-18233464 GGAGATGGGGAGCGAGAAGATGG - Intergenic
1135185722 16:20314073-20314095 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1135269743 16:21058837-21058859 GGAGGTGGGGGGCAAGGAGAGGG + Intronic
1135664853 16:24327013-24327035 GGTGATGGGGATGAAGGAGGTGG + Intronic
1135978348 16:27126319-27126341 AGGGATTGGGAGCAAGGAGAGGG + Intergenic
1136153210 16:28365517-28365539 GGTGGTGGGGGGCAGTGAGCTGG + Intergenic
1136209876 16:28749756-28749778 GGTGGTGGGGGGCAGTGAGCTGG - Intergenic
1136361100 16:29780304-29780326 GGTGTTGGGGTGCAAGGGGACGG - Exonic
1136534942 16:30893863-30893885 GGTGATGGCGACCATCGAGAAGG - Exonic
1137403046 16:48168890-48168912 GGTGGTGGGGGGCAAGGAAAGGG + Intronic
1137513695 16:49124186-49124208 AGTGCTGGGGAACAATGAGGAGG - Intergenic
1137553179 16:49454303-49454325 GGTGAGAGGGAGCAATGGAAAGG + Intergenic
1137954904 16:52819450-52819472 GGTTATGGGGTGCTATGTGATGG + Intergenic
1138137911 16:54539569-54539591 GATGATGGGCAGGAAGGAGATGG - Intergenic
1138215988 16:55205983-55206005 TGTGATGAGGATCAATGAGACGG + Intergenic
1138349163 16:56337358-56337380 GGTGCTGGGGAGCAGTGTGTGGG + Intronic
1138543229 16:57701103-57701125 GGTAAGGGGGAGGAAGGAGAAGG + Intronic
1138848499 16:60596918-60596940 GGTGGTGGGGAGATATGGGAGGG + Intergenic
1138884942 16:61065115-61065137 GGGGGTGGGGAGCAAGGCGAGGG + Intergenic
1138989448 16:62373620-62373642 GGTGTTGGGGGTCAGTGAGAAGG - Intergenic
1139473675 16:67191957-67191979 GAAGTTGGGGAGGAATGAGAAGG - Intergenic
1140039552 16:71397028-71397050 GGTGAGGGGGAGCCCTGAAAGGG - Intergenic
1140523468 16:75602280-75602302 GGTGATGCGCAGCAATGTGCTGG + Intronic
1140691352 16:77487532-77487554 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1203141650 16_KI270728v1_random:1771232-1771254 GAGGATGGGGAGGAATGAGGGGG + Intergenic
1142640543 17:1283254-1283276 CGTGAGGGGGTGAAATGAGACGG + Intronic
1143020429 17:3914700-3914722 TGTGATGGTGAGGAAGGAGAAGG + Intronic
1143283054 17:5769106-5769128 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1143307692 17:5960615-5960637 GGTGGTGGGGAGCTAGGGGAGGG + Intronic
1143426759 17:6845730-6845752 GGGGATGGGGCGCAAGGGGAGGG - Intergenic
1143484651 17:7247035-7247057 GGTGGTGGGGAGTGATGAAATGG - Intronic
1143819613 17:9549716-9549738 GGAGATGGGGAGGAGGGAGATGG + Intronic
1143910270 17:10243295-10243317 GGGGTTGGGGAGCGGTGAGAAGG + Intergenic
1143973156 17:10810432-10810454 GGTGATGAGCAGCAAGGAGGTGG - Intergenic
1144705708 17:17366649-17366671 GGTGAGGTGGAGAAGTGAGATGG + Intergenic
1144717769 17:17446243-17446265 TGTGGTGGGGAGCAATGAAAGGG + Intergenic
1145285935 17:21506065-21506087 GGCTAGGGGGAGCAAGGAGATGG - Intergenic
1145302465 17:21650281-21650303 GGTGATGGTGAGGAAGGTGATGG + Intergenic
1145347854 17:22053042-22053064 GGTGATGGTGAGGAAGGTGATGG - Intergenic
1145854572 17:28141375-28141397 GGTGATGGGTAACACTGAGTAGG + Intronic
1146127403 17:30239778-30239800 GGTGATGGGGTGCTAGGAGGAGG - Intergenic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1147033348 17:37660075-37660097 GAGGATGGGGAGGAATGTGAAGG + Intergenic
1147392429 17:40118490-40118512 TGAGATGGGAAGCCATGAGAGGG + Intergenic
1147522960 17:41191988-41192010 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1147620779 17:41865286-41865308 GGAGATGGAGAGCATGGAGACGG - Exonic
1147740741 17:42669896-42669918 GGTGAGGGGGAGAAGGGAGAAGG - Exonic
1148680653 17:49471689-49471711 TGTGATGGAAAGCCATGAGAGGG - Intronic
1149061355 17:52426014-52426036 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1149565039 17:57635381-57635403 GGAGATGGGGTGCAGAGAGAAGG - Intronic
1150058981 17:62047554-62047576 GGGGATAGGGAGCATGGAGAGGG + Intronic
1151935240 17:77257254-77257276 GGTGATGGGGATGAAGGAGATGG - Intergenic
1152299189 17:79485375-79485397 GGAGAGGGGGAGGAATTAGAGGG + Intronic
1152717669 17:81907665-81907687 GGGGATGGGGAGCAGTGGGCAGG + Intronic
1153463368 18:5362064-5362086 GGGGGTGGGGAGCAAAGGGAGGG + Intergenic
1154223786 18:12481710-12481732 GGTGGTGGGGAGCACTGAAAGGG + Intronic
1154438787 18:14368465-14368487 GGAGATGGGATGCAGTGAGAAGG - Intergenic
1155281248 18:24242126-24242148 GGGGGTGGGGGGCAAGGAGAGGG + Intronic
1155344088 18:24841565-24841587 GGAGAAGGGGAGCGAAGAGATGG - Intergenic
1155400914 18:25438013-25438035 GGTGGTGGAGAGCAACGATAGGG - Intergenic
1155433628 18:25787909-25787931 GGAGATGGGGACCAGTGAGTAGG - Intergenic
1155566727 18:27143792-27143814 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1158494582 18:57942903-57942925 GTTGATGGGGAGGAAAGACATGG + Intergenic
1158658777 18:59365903-59365925 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1158671806 18:59482038-59482060 AGGGATGGGGAGCAAGGGGAGGG - Intronic
1159082296 18:63748930-63748952 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1159467969 18:68810831-68810853 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160409798 18:78667847-78667869 GTGGATGGGGAGGAGTGAGAGGG - Intergenic
1160808512 19:1002960-1002982 GGTGATGGGGAACGATGGAAGGG + Intronic
1161209050 19:3056846-3056868 GGTGACAGGGAGCCATGGGAGGG - Intronic
1162013322 19:7830698-7830720 GGGGATGGGGAGCCCTGAGGGGG - Intronic
1162127637 19:8507926-8507948 GGTGGCGGGGGGCAAGGAGAAGG + Intergenic
1162544991 19:11323874-11323896 GGTGTTTGGGAGCAAAGAAAAGG + Exonic
1163739145 19:18999979-19000001 GGGCATGAGGAGCAATGAGAAGG - Intronic
1163778072 19:19229498-19229520 GGTGCTGGGGAGCCATGCAAGGG + Intronic
1164219281 19:23178904-23178926 GGAGAAGAGCAGCAATGAGATGG - Intergenic
1164591839 19:29511771-29511793 GGGGACGAGGAGAAATGAGAGGG + Intergenic
1164591851 19:29511815-29511837 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164592181 19:29513101-29513123 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164592197 19:29513143-29513165 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592203 19:29513164-29513186 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164592211 19:29513186-29513208 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592238 19:29513272-29513294 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592344 19:29513670-29513692 GGAGATGAGGAGGAAGGAGAGGG + Intergenic
1164592388 19:29513791-29513813 GGAGATGAGGAGGAAGGAGAGGG + Intergenic
1164592399 19:29513836-29513858 GGGGATGAGGAGGAAAGAGAAGG + Intergenic
1164592434 19:29513963-29513985 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164592453 19:29514027-29514049 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592458 19:29514049-29514071 GGTGATGAGGAGGAAGAAGAGGG + Intergenic
1164592588 19:29514432-29514454 GGGGATGAGGAGGAAGGAGATGG + Intergenic
1164592622 19:29514541-29514563 TGTGATGAGGAGGAAGGAGAGGG + Intergenic
1164592638 19:29514602-29514624 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592673 19:29514724-29514746 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1166520943 19:43479590-43479612 GGGCCTGGGGAGCAAAGAGACGG + Exonic
1166543672 19:43622028-43622050 GGTGATGGGGAGCTAGGCAAAGG + Intergenic
1167021823 19:46882643-46882665 GGAGGTGGGGAGCAAGGAAAGGG - Intergenic
1167077593 19:47258743-47258765 AGTGATGGGGAGCCATGAAAAGG - Intronic
1167376917 19:49117371-49117393 GGTGCTGGGGAGCTATGGGAGGG + Intronic
1167411685 19:49347719-49347741 GCTGCTGGGGAGCTATGGGAGGG - Intronic
1167442175 19:49514633-49514655 GGCGCTGGGGAGCCATGGGAGGG - Intronic
1167525803 19:49983139-49983161 TGTGCTGGGGAGCCATGGGAGGG - Intronic
1167562262 19:50232912-50232934 GGTGCTGGGGAGCTGTGGGAGGG + Intronic
1167573410 19:50305087-50305109 GGCAATGGGGAGCCATGGGAAGG + Intronic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1168210133 19:54884217-54884239 GGTGCGTGGGAGCAGTGAGATGG - Intronic
1168238445 19:55077974-55077996 GGTAATGGGGAGCGATGGAAGGG - Intronic
1168527893 19:57103423-57103445 GGAGATGGGGGGAAATGAGCAGG - Intergenic
925002639 2:418098-418120 GGTTATGGAGAGCCATGAAAAGG - Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
925473411 2:4186790-4186812 GGAGGTGGGGAGCAAGGGGAGGG - Intergenic
925766035 2:7236265-7236287 GGTGATGGGGAACAATTAAATGG - Intergenic
926119629 2:10235041-10235063 GCTGATGGGGAGCAGCCAGAAGG - Intergenic
926478998 2:13364501-13364523 GGTGGTGGGGGGCAAGGGGATGG + Intergenic
926846615 2:17147879-17147901 GGAGAAGGGGAGCAAAGAGAGGG + Intergenic
927168992 2:20352375-20352397 GGTGATGGGGAGCAATGAGATGG - Intergenic
927297721 2:21474514-21474536 GGGGGTGGGGGGCAAGGAGAAGG - Intergenic
927433393 2:23046225-23046247 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
928338160 2:30416864-30416886 GAGGATGGGGTGCGATGAGATGG - Intergenic
928475366 2:31621260-31621282 GGAGATGAGGAGCAATGGAAAGG - Intergenic
928957708 2:36888352-36888374 TGAGATGGGGAGCCATGGGAGGG - Intronic
929064193 2:37956797-37956819 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
929255564 2:39807838-39807860 GGGGATGGGGGGCAAGGAGAGGG - Intergenic
929817561 2:45246945-45246967 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930188062 2:48429666-48429688 GGTGATGGGGAGCAGGGAAAAGG + Intergenic
930222467 2:48759108-48759130 GGGGATGGGGGGCAAGGGGAGGG - Intronic
930340884 2:50112988-50113010 GGAGATAATGAGCAATGAGAGGG - Intronic
930344983 2:50168888-50168910 GGTGTTGGGGAGGAAAGAAAAGG - Intronic
930359887 2:50364090-50364112 GGGGTTGGGGAGCAAGGGGAGGG + Intronic
930762398 2:55050377-55050399 GGGGTTGGGGAGGACTGAGAGGG + Exonic
930959514 2:57242268-57242290 GGAGGTGGGGAGCAAGGGGAAGG + Intergenic
931123342 2:59245546-59245568 TGAGATGGGAAGCTATGAGAGGG - Intergenic
931160924 2:59689272-59689294 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
931547227 2:63402315-63402337 GGGGGTGGGGAGCAAGGAGAGGG + Intronic
932429388 2:71665014-71665036 AGTCATGGTGAGCAATCAGATGG + Intronic
933633294 2:84680618-84680640 GGACATGGGGAGCAATGGAAGGG + Intronic
933862879 2:86487644-86487666 GGTGATGGGGAGTTAAGAGTGGG - Intronic
935184535 2:100720162-100720184 GCTGATGGGAAGTGATGAGATGG - Intergenic
935690791 2:105730660-105730682 GGTGAAGGGGAGAAATCCGATGG - Intergenic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
936986328 2:118314371-118314393 GGTGCTGGGGAACTATCAGATGG - Intergenic
937741230 2:125356953-125356975 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
937881153 2:126865865-126865887 GGTGCTGGGGTGGAATGATATGG - Intergenic
938997960 2:136700755-136700777 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
939249715 2:139667960-139667982 GGTGATTGGTGGCAATGAGGTGG + Intergenic
939270723 2:139936085-139936107 GGTGGTGGGAGGCAAGGAGATGG - Intergenic
939419744 2:141951324-141951346 GGAGATTGGGAGGAATGTGAGGG - Intronic
939753151 2:146074304-146074326 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
939986682 2:148835753-148835775 TGTGATGGGAAGCCATGGGAAGG - Intergenic
940010509 2:149049851-149049873 GGGGATGGGGAGGATTCAGAGGG + Intronic
940187029 2:150997109-150997131 TGTTATAGGGAACAATGAGAAGG + Intergenic
941317370 2:164009937-164009959 GGTGCTGGTGTGTAATGAGAAGG + Intergenic
941407378 2:165107590-165107612 GGTGAATGAAAGCAATGAGATGG - Intronic
942522234 2:176816584-176816606 GGGGATGGGGGGCTAGGAGAGGG + Intergenic
942899326 2:181095218-181095240 GGTGGTGGGGGGCAAGGGGAAGG + Intergenic
943317475 2:186408252-186408274 TGTGATTGGAAGAAATGAGAAGG + Intergenic
944119024 2:196220839-196220861 GGTGAAGTGGAGGATTGAGAGGG - Exonic
945943321 2:215971139-215971161 GGGGATGGGGCGCAAGGAGAGGG + Intronic
945987510 2:216367116-216367138 GGTGATGGGGAGCAGGGAGGTGG + Intronic
946263407 2:218516540-218516562 GGGGATGGGGGGCAAGGGGAGGG + Intronic
946555115 2:220847830-220847852 GATGATGGAGAGGAATGAGAAGG + Intergenic
946716105 2:222556609-222556631 GGGGATGGGGAGGAGTGAGGGGG - Intronic
947506381 2:230711446-230711468 GGAGATGGGAAGCAATTTGAAGG - Intergenic
947567063 2:231201057-231201079 GGTGGAAGGGAGCAAGGAGAGGG + Intronic
947935035 2:233997415-233997437 GGTGAATGGGAGCAAAGAGAGGG - Intronic
948616273 2:239201311-239201333 GGGATTTGGGAGCAATGAGAGGG + Intronic
948662717 2:239516827-239516849 TGTGATGGTGAGCACTGGGATGG - Intergenic
948720199 2:239894491-239894513 GGTGTTGGGGACTGATGAGAGGG - Intronic
1169030402 20:2402387-2402409 GGCCAAGGGGAGCAAAGAGATGG - Intronic
1169086631 20:2829862-2829884 AGCTATGGGGAGGAATGAGAGGG + Intergenic
1171197486 20:23211531-23211553 GATGATGTGGAGGAAAGAGAGGG - Intergenic
1171555044 20:26074261-26074283 GGTGATGGTGAGAAAGGTGATGG - Intergenic
1172202105 20:33133658-33133680 GGTGATGAGGAGGAAAGAGTTGG + Intergenic
1172389581 20:34558098-34558120 GGTGATGGGGAATAAGGAAAAGG - Intronic
1172908285 20:38385940-38385962 CGTGGTGGGGAGCAAAGAGAGGG + Intergenic
1173007663 20:39152510-39152532 GGGGATGGGGACAAATGAGTCGG + Intergenic
1173162696 20:40664251-40664273 GGGGATGGGGAGGATGGAGACGG - Intergenic
1173387176 20:42599489-42599511 AGAGATGGGGTGCAATGGGAGGG + Intronic
1173523461 20:43715660-43715682 GGTGAGAAGGAGCAGTGAGACGG - Intronic
1173825131 20:46043323-46043345 GGTGAAGGGGAGCTCAGAGAGGG + Exonic
1173846405 20:46191427-46191449 GGGGATGGGGGCCAATGGGAAGG + Intronic
1174355980 20:49998171-49998193 GGCAATGGGGAGCCATGGGAGGG + Intergenic
1174432957 20:50484053-50484075 GGTGGTGGGGAGGAGGGAGAGGG - Intergenic
1174453100 20:50631594-50631616 GGTGACTGGGAGCCATGGGAGGG + Intronic
1176283104 20:64326565-64326587 GTTGAAAGGGAGCAATGACATGG - Intergenic
1176456896 21:6920967-6920989 GGAGATGGGATGCAGTGAGAAGG + Intergenic
1176653195 21:9568086-9568108 GGTGATGGTGAGGAAGGCGATGG + Intergenic
1176835069 21:13786027-13786049 GGAGATGGGATGCAGTGAGAAGG + Intergenic
1177083066 21:16666107-16666129 GGTGATGGTGAGCAATGAAGTGG + Intergenic
1177341038 21:19800617-19800639 GGGGATGGGGAGCAAGGAGAGGG - Intergenic
1177449790 21:21251313-21251335 GGGGGTGGGGGGCAAGGAGAGGG - Intronic
1178367780 21:32001618-32001640 GGTGAGGGGGAGTGATGAAAGGG + Exonic
1178527704 21:33346215-33346237 GGTTATGGGGAGAAAAGAGATGG + Intronic
1179102321 21:38365049-38365071 GGAGGTGGGGGGCAATGGGAGGG + Intergenic
1179254563 21:39704052-39704074 GGTGATGGAGGGCAAGGGGAGGG - Intergenic
1179798646 21:43799992-43800014 GGTGCTGGTGGGGAATGAGATGG + Intronic
1179887122 21:44318958-44318980 GGTGATGGGGAACACTGGGGTGG + Intronic
1181314036 22:21960547-21960569 TGTGACCGGGAGCAGTGAGAGGG - Intronic
1181776769 22:25165821-25165843 GGTGAGAGGGAGGAATGTGAGGG + Intronic
1181884454 22:26009098-26009120 AGTGATGGGGAGAGATCAGAGGG - Intronic
1181908432 22:26218397-26218419 GGAGGTGGGGAGCAAGGGGAGGG - Intronic
1183243504 22:36675679-36675701 GGAGATGGGGAGCTGTGAGCTGG - Intronic
1183348153 22:37319239-37319261 GGTGACGGGGAGCCAGGAAAGGG + Intergenic
1183747300 22:39699033-39699055 GGTGATGGGGAGTGATGAGGAGG - Intergenic
1183747337 22:39699193-39699215 GGTGATGGGGAGTGATGGGGAGG - Intergenic
1183747349 22:39699226-39699248 GGTGATGGGGAGTGATGGGGAGG - Intergenic
1184519670 22:44985846-44985868 GGTGATGGTGATCATTGTGATGG - Intronic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185136139 22:49073807-49073829 GGTGATGGTGAGCATGGTGATGG - Intergenic
950202820 3:11056975-11056997 GGTGGTGGGGAGCCATGGGAAGG - Intergenic
950238242 3:11342358-11342380 GGGGATGGGGAGCTGGGAGATGG - Intronic
950914269 3:16627879-16627901 CTTGATGGGGTGGAATGAGATGG + Intronic
951532816 3:23713694-23713716 GATGATGGGGAGTAATAAAAAGG - Intergenic
952284190 3:31952555-31952577 CAGCATGGGGAGCAATGAGAAGG + Intronic
952503123 3:33982930-33982952 GGGGATGGGGAGCAAAGGGAGGG - Intergenic
953000511 3:38928371-38928393 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
953265072 3:41379055-41379077 GGAGATGGGAAGCAAGGGGAGGG + Intronic
953306151 3:41831690-41831712 GGGGATGGGGAGCAAGGGGAGGG - Intronic
954198344 3:49009294-49009316 GGGGGTGGGGAGCAATGGGAGGG - Intronic
954322509 3:49841749-49841771 AGAGATGGGGAGCAATGACACGG + Intronic
954673943 3:52305377-52305399 AGGAATGGGGAGCAATGAGCAGG + Intergenic
954701662 3:52453882-52453904 AGTGGTGGGGACCAAGGAGAAGG - Intronic
954718132 3:52537145-52537167 GGTGAAGGGCAGGCATGAGAGGG - Intronic
954829185 3:53404182-53404204 GGGGCTAGGGAGCAAGGAGAGGG - Intergenic
954930707 3:54278834-54278856 GGGGATGGGGGGCAAGGGGAGGG + Intronic
954947252 3:54436778-54436800 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
955272302 3:57513367-57513389 GGGGATGGAGGGCAAGGAGAGGG + Intronic
957027726 3:75203396-75203418 GGGGGTTGGGAGGAATGAGAAGG - Intergenic
957920113 3:86735869-86735891 GGTTATGGGTAGAAAAGAGAAGG - Intergenic
957964395 3:87303891-87303913 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
958415297 3:93866733-93866755 GGTGGTGGGAGGCAAGGAGAGGG + Intergenic
958895876 3:99828900-99828922 GATGATAGGCAGCATTGAGAGGG - Intronic
958895879 3:99828922-99828944 GATGATGGGCAGCATTGAGAGGG - Intronic
958895883 3:99828944-99828966 GATGATGGGCAGCATTGAGAGGG - Intronic
959345823 3:105193050-105193072 GGGGATGGGAAGCAAGGGGAAGG + Intergenic
959506480 3:107162255-107162277 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
960500877 3:118437004-118437026 GGGGAGGGGGAAGAATGAGAGGG - Intergenic
960768322 3:121163422-121163444 GTGGATGGGGGGCAAGGAGAGGG + Intronic
961114247 3:124315202-124315224 TGGGATGGGGAGCAAGGAGTAGG - Intronic
961607939 3:128111393-128111415 GGAGATGGGGAAGAATGGGAGGG - Intronic
961997383 3:131260110-131260132 GGAGAGGTGGAGAAATGAGATGG + Intronic
963216831 3:142757644-142757666 GGGGATGGGGGGCAAGGGGAGGG + Intronic
963463591 3:145648679-145648701 AGTGATGGGGAGAAGGGAGAGGG + Intergenic
963654732 3:148032129-148032151 GGTGATGGGAGGCAAGGGGAGGG - Intergenic
963707004 3:148699485-148699507 GGTGGTGGAGAGGAAGGAGAAGG - Intronic
963833138 3:150030157-150030179 GGCGATGGGGAGTTACGAGAGGG + Intronic
965362075 3:167753567-167753589 GGGGGTGGGGAGCAGTGAGGTGG + Intronic
966058612 3:175728136-175728158 GGTCAAGGGGAGCAATGGAAAGG + Intronic
966554669 3:181245376-181245398 GGGGATGGGGAGCGAGGGGAAGG + Intergenic
967012903 3:185453394-185453416 AGGGATGGGGGGCTATGAGAAGG - Intronic
967090880 3:186133891-186133913 AGTGGTGGGGGGCAAGGAGAGGG - Intronic
967658013 3:192073979-192074001 GGAGAAGGGCGGCAATGAGATGG + Intergenic
968120564 3:196123039-196123061 GGTGGTGGGCAGCAGGGAGATGG - Intergenic
968163684 3:196447537-196447559 GGTGATGGGGGGTGAGGAGAGGG - Intergenic
968559420 4:1270657-1270679 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
969175148 4:5393152-5393174 GGGGTTGGGGAGGAATGGGAGGG - Intronic
970123126 4:12779619-12779641 GGTCAAGGGGAGGAATGATATGG + Intergenic
970411568 4:15813587-15813609 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
970496880 4:16635141-16635163 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
972261586 4:37413971-37413993 GGGGGTGGGGGGCAAGGAGAGGG + Intronic
972382448 4:38532002-38532024 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
972446533 4:39149554-39149576 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
972500146 4:39670306-39670328 GGGGATGGGGAGCAAGGGGAAGG - Intergenic
972944218 4:44234285-44234307 GGTTATGGGCATCTATGAGATGG + Intronic
973151768 4:46897257-46897279 GGTGGTGGGGAGAAAGGAGTTGG - Intronic
973633107 4:52838056-52838078 GCTGCTGGGGAGCAATGGGGAGG - Intergenic
973651681 4:53003078-53003100 GGTGGTGGGGCCCAATGGGAGGG - Intronic
973914340 4:55618360-55618382 GGTGTTGGGGGGCAAGGGGAGGG - Intronic
974826226 4:67134175-67134197 GGAGATTGGGAGGAAGGAGAGGG + Intergenic
974928314 4:68329230-68329252 GGTTGTGGGGAGCAGTGGGAGGG - Intronic
975075639 4:70205057-70205079 GGGGGTGGGAAGCAAGGAGAGGG + Intergenic
975424396 4:74209333-74209355 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
975455459 4:74585112-74585134 GGGGATGGGGAGAGAAGAGAGGG + Intergenic
975830495 4:78363484-78363506 GGGGAAGGGGAGCACAGAGAAGG - Intronic
976819253 4:89186515-89186537 GGGAATGGGGGGCAAGGAGAGGG - Intergenic
976903026 4:90203338-90203360 GGTGGTGGGGAGCTAGGAGAGGG - Intronic
977204030 4:94149681-94149703 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
977711280 4:100128915-100128937 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
977901707 4:102429637-102429659 GGAGATGGGGAGGAAAGAAATGG + Intronic
978099102 4:104814947-104814969 GGGGGTGGAGAGCAATGGGAGGG + Intergenic
978376803 4:108082511-108082533 GGAGATGGGGTACAATGACATGG + Intronic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
981110472 4:140928424-140928446 AGGGAGGGGGAGCAAGGAGAAGG + Intronic
981122151 4:141064714-141064736 GGTGATGGGCAGAAAAGGGAGGG + Intronic
981243735 4:142509368-142509390 GGGGATGGGGGGCAAGGGGAGGG - Intronic
981741491 4:148006871-148006893 GCTGATGGGGAGGAAGGAAAGGG - Intronic
981890086 4:149726222-149726244 GGTTTTGAGGAGCAAGGAGAAGG - Intergenic
982253850 4:153433646-153433668 GGTGTCGGGGAGAAATGAAAGGG + Intergenic
982324432 4:154114801-154114823 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
982685963 4:158489241-158489263 GGGGTTGGGGAGCAAGGGGAGGG - Intronic
982994228 4:162320251-162320273 GGTGGTGGGGACTAATGAGAGGG - Intergenic
983082154 4:163399807-163399829 AGGGATGGGGGGCAATGGGAGGG + Intergenic
983093134 4:163529539-163529561 GGAGATGGGGAGGAGTAAGAGGG + Intronic
983543940 4:168942233-168942255 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
984325804 4:178249010-178249032 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
984525611 4:180856010-180856032 GGGGTTGGGGGGCAATGGGAAGG - Intergenic
984932175 4:184857772-184857794 GGTGATGGGAAGTAAGGAGGAGG + Intergenic
985777639 5:1853050-1853072 GGAAATGGGGAGCAAGGTGACGG - Intergenic
985923913 5:3000807-3000829 GGTGATGGGGAGAAAGCAGGCGG + Intergenic
986513466 5:8534377-8534399 GGAGGTGGGGAGCAAGGGGAGGG - Intergenic
987000654 5:13656077-13656099 GGTAATGGGGAGCAGTGTCATGG - Intergenic
987773705 5:22337370-22337392 GGTGCTGGGGTGGAATGATATGG + Intronic
988061982 5:26183185-26183207 GGGGATGGGGGGCAACGGGAGGG - Intergenic
988441253 5:31236441-31236463 GGTGATGGGAAGCAGAGAAAAGG + Intronic
988787618 5:34579131-34579153 GGAGAGGGGGAGGAAGGAGAAGG + Intergenic
989246515 5:39261176-39261198 GGGGATGGGGAGCGAGGGGAGGG + Intronic
989359080 5:40578898-40578920 GGGGGTGGGGGGCAAGGAGAGGG + Intergenic
989397215 5:40970749-40970771 GGGGATGGGGGGCAAGGGGAGGG - Intronic
989619203 5:43368007-43368029 TGTGATGGGGTGCAGTGAAATGG + Intergenic
989813662 5:45709409-45709431 GGAGATAGGAAGCAATAAGAGGG - Intergenic
991113376 5:62926583-62926605 GGGGGTGGGGGGCAAGGAGAGGG + Intergenic
991204935 5:64039373-64039395 GGGGATGGGGTGGAATGATATGG + Intergenic
991583197 5:68177796-68177818 GCTGATGGGGAAGAATGAGTAGG + Intergenic
992294008 5:75309151-75309173 GTTGATGGGTGGTAATGAGATGG - Intergenic
992640345 5:78763479-78763501 GCAGATGAGGAGGAATGAGAGGG + Intronic
993299382 5:86188548-86188570 GGTTGTGGGGAACAAAGAGAAGG + Intergenic
993397262 5:87405734-87405756 GGTGAGTGGGAGCAAGTAGAGGG - Intronic
994720660 5:103376203-103376225 GGGGATGGGGGGTAATGTGAGGG + Intergenic
994990785 5:106994449-106994471 GGTGGTGGAGGGCAATGGGAGGG - Intergenic
995295119 5:110511293-110511315 GGGGGTGGGGAGTAAGGAGAGGG + Intronic
995643760 5:114287598-114287620 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
995666691 5:114550436-114550458 GGGGTTGGGGAGCAAGGGGAGGG + Intergenic
995951904 5:117725362-117725384 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
996660709 5:125998948-125998970 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
996798463 5:127376523-127376545 GGTGCTGGTGGGCAATGGGATGG + Intronic
997197980 5:131992289-131992311 GGTAATGGGGAGCCAGGAAAGGG + Intronic
997217303 5:132123603-132123625 GGGGGTGGGGGGCAAGGAGAGGG - Intergenic
997486935 5:134239100-134239122 TGGGGTGGGGAGCAAGGAGATGG - Intergenic
997858904 5:137398216-137398238 GCTGATGGGTTGCAATGAGGTGG + Intronic
998372425 5:141670490-141670512 GGTGAGGGGGAGCCAAGGGATGG - Exonic
998377368 5:141699994-141700016 GGAGATGGAGAGAAGTGAGAGGG + Intergenic
998824200 5:146084396-146084418 GGTGTTGGGGAGTAAGGAGGAGG + Exonic
998972161 5:147604966-147604988 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
999008105 5:148005010-148005032 GGTGATGGGAATAAATAAGATGG + Intergenic
999368535 5:151038720-151038742 AGTGATGACGAGCCATGAGAAGG + Intronic
999862608 5:155664737-155664759 GGTGTTGGGGACAGATGAGATGG - Intergenic
1000037365 5:157459771-157459793 GGTGGAGGGGAGGAAGGAGAGGG + Intronic
1000584439 5:163079162-163079184 GGTGATGGGGGCCAAGGGGAGGG + Intergenic
1001372078 5:171215045-171215067 GGGGATGGGGGGCAAGGGGATGG - Intronic
1001711765 5:173784547-173784569 GGTGATGGGGATGAAGAAGAGGG - Intergenic
1001949458 5:175806111-175806133 GGTGATGGGGAGCCATTGCAGGG - Intronic
1002079189 5:176727573-176727595 GGTGATGGACAGCATGGAGAGGG - Intergenic
1003277558 6:4665388-4665410 GTGGGTGGGGAGTAATGAGAGGG - Intergenic
1005267947 6:24132835-24132857 GGGGGTGGGGAGCAAGGGGATGG - Intronic
1005295735 6:24424957-24424979 GGTCATGGGAAGCCATTAGAGGG + Exonic
1006109857 6:31737942-31737964 GGTGATGAGGAGGATAGAGAAGG - Intronic
1006257926 6:32845726-32845748 GGTGATGAGAAGCACTGAGCGGG + Exonic
1006282241 6:33063600-33063622 GGGCATGGGGAGCAAGGGGAGGG - Intergenic
1007046958 6:38785623-38785645 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
1007521023 6:42452020-42452042 GAGGATGGGGAGCAATGCAAAGG - Exonic
1008069795 6:47087702-47087724 GAGGATGGGGAGCAAGGGGAGGG + Intergenic
1008286852 6:49663813-49663835 GGTGCTGGGGAGCTAGGGGAGGG - Intergenic
1008628963 6:53346052-53346074 GGTGGTGGGGGGCAAGGGGAGGG - Intronic
1009280606 6:61746299-61746321 GGGGATGGGGGGCAAGGGGAGGG - Intronic
1009597031 6:65748586-65748608 GGTGATGAGAAGTGATGAGAAGG - Intergenic
1009604454 6:65849028-65849050 TGAGATGGGGACTAATGAGAGGG - Intergenic
1010593727 6:77739571-77739593 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1010858587 6:80876138-80876160 GGTAGTGGGGAGCAAGGGGAGGG - Intergenic
1011080515 6:83485753-83485775 GGGGCTGGGGGGCAATGGGAGGG + Intergenic
1011133505 6:84075311-84075333 GGTATTGGTGAGCACTGAGAAGG + Intronic
1011201121 6:84837473-84837495 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1011393538 6:86881076-86881098 GGGTATGGGGAGCAAGGAGGGGG - Intergenic
1011675719 6:89731609-89731631 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1011718114 6:90128128-90128150 GGTGCTGAGGAGGAATAAGAGGG - Intronic
1011992056 6:93534127-93534149 GGTGATGGGGAGCAAAGGGAGGG - Intergenic
1012667967 6:102001347-102001369 GGGGGTGGGGAACAAGGAGAGGG - Intronic
1012697624 6:102408466-102408488 GGGGAAGGGGAGCAAAGGGAAGG - Intergenic
1012850768 6:104444165-104444187 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
1012953031 6:105539137-105539159 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1012979048 6:105810811-105810833 GGTGGTGGGGAGCAGAAAGAGGG + Intergenic
1014070120 6:117171650-117171672 GAAGTTGGGGAGCAAGGAGAAGG + Intergenic
1014190870 6:118495277-118495299 GGTGCTGGGGTGGAATGACACGG + Intronic
1014275754 6:119386412-119386434 GGGGATGGGGAGCAAGGGGAGGG + Intergenic
1014579629 6:123121126-123121148 GGGAATGGAGAGCTATGAGAAGG + Intergenic
1014863124 6:126495917-126495939 GGGGATGGGGTGGAATGATATGG - Intergenic
1014896794 6:126911061-126911083 GGTGATTGGGAGTTATGAAATGG - Intergenic
1015084020 6:129265567-129265589 TGTAATGGGGAGAAATGGGAAGG + Intronic
1015156496 6:130102173-130102195 GGAGATGGGAAGCAATGGAAAGG - Intronic
1015385761 6:132621406-132621428 GGGGGTGGGGGGCAAGGAGAGGG - Intronic
1015586705 6:134783815-134783837 GGTGATGGAGATCATAGAGATGG - Intergenic
1016120738 6:140339058-140339080 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
1016593697 6:145774950-145774972 GGGGATAGGGAGCAAGGGGAGGG - Intergenic
1016697858 6:147018437-147018459 TGTAGTGGGGAGCAAGGAGATGG + Intergenic
1016946172 6:149536232-149536254 GGGAATAGGGAGCACTGAGAGGG - Intronic
1016991630 6:149933745-149933767 GGTGGTGGGGAGCAAGGTAATGG + Intergenic
1017423305 6:154295450-154295472 GGTGGTGGGGTGCGGTGAGATGG - Intronic
1017523300 6:155220906-155220928 GGAGGTGGGGAGCTAGGAGACGG - Intronic
1017686640 6:156920155-156920177 GGTGAAGGGGTGCAATGAGGAGG - Intronic
1018391443 6:163344696-163344718 GGAGGTGGGGAGCAATCAGCCGG - Intergenic
1018907653 6:168084827-168084849 TGTGATGGGGAGGAATGAGGTGG - Intergenic
1018961049 6:168448618-168448640 GGTGATGGGGAGGATGGTGATGG + Intronic
1019784987 7:2970953-2970975 GGGGCTGAGGAGCAGTGAGAAGG + Intronic
1021169960 7:17387248-17387270 GGGGGTGGGGGGCAAGGAGAGGG - Intergenic
1021897909 7:25255032-25255054 GGTGATGGGGAGAAATGAGATGG - Intergenic
1022306824 7:29154379-29154401 GGTGAAGGGAGGCAAAGAGAAGG - Intronic
1022542382 7:31149703-31149725 GTTGGTGGGGAGCAAGGGGAGGG + Intergenic
1022970453 7:35512083-35512105 GTTGATGAAGAACAATGAGAGGG + Intergenic
1023073397 7:36459725-36459747 GGTCATGGGGTGCAACGTGAAGG + Intergenic
1023200463 7:37692137-37692159 GGGGATGGGGAGCTAGGGGAGGG - Intronic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1024664308 7:51530703-51530725 AGGGGTGGGGAGCAAGGAGAGGG - Intergenic
1024742296 7:52367563-52367585 GGGCATGGGGAGCAAGGGGAGGG - Intergenic
1025625755 7:63219735-63219757 GGTTATGGGGGGCAGTGTGAGGG + Intergenic
1025656365 7:63523439-63523461 GGTTATGGGGGGCAGTGTGAGGG - Intergenic
1026187768 7:68095690-68095712 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1026299543 7:69085078-69085100 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1027462927 7:78478064-78478086 GGGGATAGGGAGCTAGGAGAGGG - Intronic
1027948220 7:84778472-84778494 GGGGATGGGGAGCTAGGGGAGGG + Intergenic
1028576618 7:92359212-92359234 GGGGATGGGGGGCTAGGAGAGGG - Intronic
1028916013 7:96260054-96260076 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1028958641 7:96723283-96723305 GGGGGTGGGGAGCAAAGAGAGGG + Intergenic
1029497398 7:100903433-100903455 AGTGATGGCGGGAAATGAGAGGG + Intergenic
1029615963 7:101657340-101657362 GGAGATGAAGAGCAATGGGAGGG + Intergenic
1030079461 7:105764624-105764646 GGCAATGTGGAGGAATGAGAGGG + Intronic
1030455068 7:109762072-109762094 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1031099498 7:117462006-117462028 GGGGGTGGGGAGCAAGGAGAGGG - Intergenic
1031104027 7:117517198-117517220 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
1031322920 7:120355476-120355498 GGTGGGGGGGTGCAATGAGCTGG + Intronic
1031384108 7:121125451-121125473 GGGGTTGGGGGGCAAGGAGAGGG - Intronic
1031605113 7:123759888-123759910 GGTGGTGGGGGGCAAGGGGAGGG - Intergenic
1031989462 7:128188296-128188318 TGAGATGGGGAGAAAAGAGAGGG + Intergenic
1032619336 7:133511923-133511945 AGTGGTGGGAAGGAATGAGAAGG - Intronic
1033528292 7:142238888-142238910 CCTGATAGGGAGCACTGAGATGG - Intergenic
1033963936 7:146950436-146950458 GGTGGTGGGGGGCAAGGGGAGGG - Intronic
1034321320 7:150185592-150185614 GGTGATGGGAAACAATTTGAGGG - Intergenic
1034418117 7:150975786-150975808 GGTCATAGGAAGCAAAGAGAGGG + Intronic
1035195271 7:157214089-157214111 GGAGATGGGGAGAAAGGAGGAGG - Intronic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1036085305 8:5607235-5607257 GGTGAGGGGGAGCAGAGACAGGG - Intergenic
1036803424 8:11809799-11809821 GTTCATGGAGAGCAAGGAGAAGG + Exonic
1037060499 8:14503296-14503318 GGGGATGGGGGGCAAGGGGAGGG + Intronic
1037238680 8:16752157-16752179 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1038111429 8:24503876-24503898 GGGGATGGGGAACAAGGGGAGGG + Intronic
1038360575 8:26871814-26871836 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1038858927 8:31364555-31364577 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1039199293 8:35070546-35070568 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1039258857 8:35748961-35748983 AGTGAAGGGGATCAATGAGCAGG - Intronic
1039261727 8:35779227-35779249 GGTGGTGGGGAGCAATGCAGAGG + Intronic
1039267689 8:35843636-35843658 GGGGATGGGGGGCAAGGGGAAGG - Intergenic
1039623762 8:39026245-39026267 GGAGGTGGGGAGCAAGGGGAGGG - Intronic
1039814985 8:41085596-41085618 GGTGATGGTTTGCAATGACAGGG + Intergenic
1039830935 8:41213735-41213757 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1040865831 8:52048141-52048163 GGGGGTGGGGAGCAAGGGGAAGG + Intergenic
1041155524 8:54981676-54981698 GGGGGTGGGGAGCAAAGGGAAGG + Intergenic
1041189852 8:55342460-55342482 TGAGATGGGAAGCAATTAGAGGG - Intronic
1042840257 8:73116612-73116634 GGTGATGGGCAGGAAGGAGGTGG + Intronic
1043427505 8:80162351-80162373 GGTGACAGAGAACAATGAGAAGG + Intronic
1043472797 8:80578630-80578652 GGAGAAGGGGAGCAGGGAGAAGG - Intergenic
1043552637 8:81392087-81392109 GGTGATGGGGGGCAAGGGGAGGG + Intergenic
1043760780 8:84064716-84064738 GGAGAAGGGGAGCAAGCAGATGG + Intergenic
1044599226 8:93987058-93987080 GGAGATGGGCAGCAACCAGAAGG + Intergenic
1044837774 8:96312991-96313013 GGTAAGGTGGAGAAATGAGAGGG + Intronic
1045156481 8:99479597-99479619 TGTGATGGGGAGGAATGGGAGGG - Intronic
1045432575 8:102127187-102127209 GGGGTTGGGGAGCAAGGGGATGG - Intergenic
1045559815 8:103250206-103250228 GGTGATGAGGAGGAAGAAGAGGG - Intergenic
1045874296 8:106961218-106961240 GGGGGTGGGGGGCAAGGAGATGG + Intergenic
1046048489 8:108990854-108990876 GGGGATGGGAGGCAAGGAGAGGG + Intergenic
1047225184 8:122950423-122950445 GGGGATGGGGGACAAGGAGAGGG + Intronic
1047708221 8:127523722-127523744 GCTGATGAGGAACAAGGAGAGGG + Intergenic
1047744642 8:127835446-127835468 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1048161384 8:132024860-132024882 GAAGATGGGGAGGAAGGAGAAGG - Intronic
1048299338 8:133239750-133239772 GCTGATGGGGTGGAATGAGGAGG + Intronic
1048541086 8:135342773-135342795 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1048674389 8:136761772-136761794 GGAGATGGGGAGCAAGGGGAGGG - Intergenic
1048678285 8:136809775-136809797 GGTGATGAGGCTCCATGAGAGGG + Intergenic
1048936091 8:139358311-139358333 GGGGGTGGGGGGCAAAGAGAGGG + Intergenic
1049333403 8:142068130-142068152 GGGGGTGGGGAGCAAAGGGAGGG + Intergenic
1049406762 8:142455095-142455117 GGTGATGGGGTGGGGTGAGATGG - Intronic
1050868064 9:10529568-10529590 GGGGATGGGGGGCAAGGGGAAGG + Intronic
1051743150 9:20270466-20270488 GGGGATGGGTTGCAAAGAGAAGG - Intergenic
1052123320 9:24744801-24744823 GGGGCTGGGGAACAAGGAGAAGG + Intergenic
1052219451 9:26001793-26001815 GGGGATGGGGAGCAAGGGGAGGG - Intergenic
1052457692 9:28721659-28721681 GGGGATGGGGAGAATGGAGAGGG + Intergenic
1052582942 9:30384753-30384775 GGGGGTGGGGGGCAATGCGAGGG - Intergenic
1052659653 9:31411730-31411752 GGTGGTGGGGTGCAAAGGGAGGG + Intergenic
1053028236 9:34749764-34749786 GGGGATGGGGGGCAAGGGGAGGG - Intergenic
1054356157 9:64065826-64065848 GGGAATGGGGAGCAATTAAAAGG - Intergenic
1054723829 9:68630278-68630300 GGTGATGGGGACCAAAGAGGAGG + Intergenic
1054793482 9:69277333-69277355 GGGGTTGGGGAGCAAGGGGAGGG - Intergenic
1058183104 9:101821823-101821845 GGGGATGGGCAGCAAGGGGAGGG + Intergenic
1058188201 9:101880758-101880780 AGTGATGGGGAGGTAGGAGATGG + Intergenic
1058591625 9:106571442-106571464 GGGGATGGGGAACAAGGGGAGGG + Intergenic
1058598877 9:106647319-106647341 GGTGGTGGGGAGAAATGAAAGGG - Intergenic
1058935090 9:109762863-109762885 GGTGGAGGGGAGGAAAGAGATGG + Intronic
1059313293 9:113403206-113403228 GGAGATGGGGAGGATTGAAAGGG + Intergenic
1059457658 9:114409852-114409874 GGAGATGGTGATCAATGAGAAGG - Intronic
1060234579 9:121853432-121853454 GGTGGTGGTGAGCAAGGAGAGGG + Intronic
1060248436 9:121966166-121966188 GGTGATAGGAAGTAATGAAATGG + Intronic
1060316228 9:122513683-122513705 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1060336173 9:122725269-122725291 GGGGGTGGGGAGCTAGGAGAAGG - Intergenic
1060807250 9:126585629-126585651 GGAGATGGGGACCCATGAGGAGG + Intergenic
1061164086 9:128912437-128912459 GGTGGGGAGGAGCAGTGAGATGG + Intronic
1061221574 9:129255111-129255133 GGCAATGGGGAGCCATGGGAGGG - Intergenic
1061424670 9:130491509-130491531 GGTGATGGGCAGCTTTGAGCCGG + Intronic
1185727435 X:2433545-2433567 GGGGCTGGGGAACAAGGAGAGGG - Intronic
1186858253 X:13646438-13646460 GTTGATGGGGAGAATTGGGAGGG - Intergenic
1187814316 X:23214576-23214598 GGGGATGGGGGGCAAGGGGAGGG + Intergenic
1189110589 X:38286063-38286085 GGGGAAGGGGAGGAAGGAGAAGG - Exonic
1189239994 X:39517519-39517541 GGTGGTGGGGAGTATTGACAGGG - Intergenic
1189581528 X:42412551-42412573 GGGGATGGGGAGCTAGGGGAGGG - Intergenic
1189584437 X:42443695-42443717 GGAGATAGGGAGCAATGGGATGG - Intergenic
1190920808 X:54850677-54850699 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1191805468 X:65130796-65130818 GGTGGGAGGGACCAATGAGAAGG + Intergenic
1192338012 X:70238091-70238113 GGAGGAGAGGAGCAATGAGATGG - Intronic
1192510557 X:71718360-71718382 GCAGACGGGGACCAATGAGAAGG - Intergenic
1192516140 X:71763193-71763215 GCAGACGGGGACCAATGAGAAGG + Intergenic
1192723386 X:73723811-73723833 GGGGGTGGGGGGCAATGGGAGGG + Intergenic
1192883033 X:75307989-75308011 GGGCATGGGGAGCAAGGGGAAGG - Intergenic
1193712805 X:84899028-84899050 GGTGGTGGGGGGCAAAGGGAGGG - Intergenic
1194056074 X:89133910-89133932 GGGGGTGGGGGGCAAGGAGAGGG - Intergenic
1194261726 X:91703598-91703620 GGGGGTGGGGGGCAAGGAGAGGG + Intergenic
1194661576 X:96633847-96633869 GGGGTTGGGGGGCAAGGAGAGGG + Intergenic
1194749196 X:97665686-97665708 AGTTAGGGGTAGCAATGAGAGGG + Intergenic
1195140669 X:101956160-101956182 GGGGATGGGGGGCAACGGGAGGG + Intergenic
1195338858 X:103885065-103885087 GGTGATGGGGAGCTGGGGGAGGG - Intergenic
1196232211 X:113237491-113237513 GGAGGTGGGGGGCAATGGGAGGG - Intergenic
1196244087 X:113378276-113378298 GGTGGTGGGGGGCAAGGGGAGGG + Intergenic
1197197999 X:123722568-123722590 GGGGTTGGGGAGCAAGGGGAGGG + Intronic
1199003725 X:142672024-142672046 GGGGCTGGGGAGCAAGGGGAGGG - Intergenic
1199330800 X:146555923-146555945 GGGGGTGGGGAGCAAGGGGAAGG + Intergenic
1199570254 X:149260467-149260489 AGTGATGGGAAGCTATTAGAGGG - Intergenic
1199831073 X:151549902-151549924 GGGGGTGGGGGGCAAGGAGAGGG + Intergenic
1199869307 X:151882881-151882903 GGGAATGGGGAGCTATGGGAGGG + Intergenic
1200296580 X:154925916-154925938 GGGGATGGGGTGGAATGATATGG + Intronic
1200580376 Y:4942392-4942414 GGGGGTGGGGGGCAAGGAGAGGG + Intergenic
1201945125 Y:19502930-19502952 GGTGTTGGGATGCTATGAGAGGG - Intergenic