ID: 927174185

View in Genome Browser
Species Human (GRCh38)
Location 2:20393836-20393858
Sequence CAGCAGGTATGGATGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927174185_927174190 0 Left 927174185 2:20393836-20393858 CCATGGTCCATCCATACCTGCTG No data
Right 927174190 2:20393859-20393881 TGTCCTCTCCTCCCTGGACCTGG No data
927174185_927174189 -6 Left 927174185 2:20393836-20393858 CCATGGTCCATCCATACCTGCTG No data
Right 927174189 2:20393853-20393875 CTGCTGTGTCCTCTCCTCCCTGG No data
927174185_927174193 10 Left 927174185 2:20393836-20393858 CCATGGTCCATCCATACCTGCTG No data
Right 927174193 2:20393869-20393891 TCCCTGGACCTGGTTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927174185 Original CRISPR CAGCAGGTATGGATGGACCA TGG (reversed) Intergenic
No off target data available for this crispr