ID: 927182477

View in Genome Browser
Species Human (GRCh38)
Location 2:20456418-20456440
Sequence AGGGCTACAAACACAGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927182473_927182477 23 Left 927182473 2:20456372-20456394 CCTGTGTTTTTAACTCTAGGAGT No data
Right 927182477 2:20456418-20456440 AGGGCTACAAACACAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927182477 Original CRISPR AGGGCTACAAACACAGACCA TGG Intergenic
No off target data available for this crispr