ID: 927185618

View in Genome Browser
Species Human (GRCh38)
Location 2:20480045-20480067
Sequence AGTTATCCCCAGCTGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927185618_927185628 13 Left 927185618 2:20480045-20480067 CCATGCTCCAGCTGGGGATAACT No data
Right 927185628 2:20480081-20480103 CCAGTTTCAGGGTTCCTCGTGGG No data
927185618_927185629 21 Left 927185618 2:20480045-20480067 CCATGCTCCAGCTGGGGATAACT No data
Right 927185629 2:20480089-20480111 AGGGTTCCTCGTGGGCTCAGTGG No data
927185618_927185622 1 Left 927185618 2:20480045-20480067 CCATGCTCCAGCTGGGGATAACT No data
Right 927185622 2:20480069-20480091 TGAAGGGCCATCCCAGTTTCAGG No data
927185618_927185623 2 Left 927185618 2:20480045-20480067 CCATGCTCCAGCTGGGGATAACT No data
Right 927185623 2:20480070-20480092 GAAGGGCCATCCCAGTTTCAGGG No data
927185618_927185630 24 Left 927185618 2:20480045-20480067 CCATGCTCCAGCTGGGGATAACT No data
Right 927185630 2:20480092-20480114 GTTCCTCGTGGGCTCAGTGGAGG No data
927185618_927185626 12 Left 927185618 2:20480045-20480067 CCATGCTCCAGCTGGGGATAACT No data
Right 927185626 2:20480080-20480102 CCCAGTTTCAGGGTTCCTCGTGG No data
927185618_927185632 29 Left 927185618 2:20480045-20480067 CCATGCTCCAGCTGGGGATAACT No data
Right 927185632 2:20480097-20480119 TCGTGGGCTCAGTGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927185618 Original CRISPR AGTTATCCCCAGCTGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr