ID: 927186212

View in Genome Browser
Species Human (GRCh38)
Location 2:20484396-20484418
Sequence CTTCTATAGCAGAGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927186207_927186212 3 Left 927186207 2:20484370-20484392 CCGAGCCCAGTGAGAGCATGCAA No data
Right 927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG No data
927186206_927186212 12 Left 927186206 2:20484361-20484383 CCATGAAAGCCGAGCCCAGTGAG No data
Right 927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG No data
927186205_927186212 28 Left 927186205 2:20484345-20484367 CCATCTTATTCAACTGCCATGAA No data
Right 927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG No data
927186209_927186212 -3 Left 927186209 2:20484376-20484398 CCAGTGAGAGCATGCAATCTCTT No data
Right 927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG No data
927186208_927186212 -2 Left 927186208 2:20484375-20484397 CCCAGTGAGAGCATGCAATCTCT No data
Right 927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927186212 Original CRISPR CTTCTATAGCAGAGGGAGCC AGG Intergenic
No off target data available for this crispr