ID: 927186278

View in Genome Browser
Species Human (GRCh38)
Location 2:20484821-20484843
Sequence TACCATCACATTTTGGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927186278_927186289 18 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186289 2:20484862-20484884 GGGAGCTGATTTCACTTAGATGG No data
927186278_927186286 -4 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186286 2:20484840-20484862 GGTATTAGGAGGTAAGGGCTTGG No data
927186278_927186287 -3 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186287 2:20484841-20484863 GTATTAGGAGGTAAGGGCTTGGG No data
927186278_927186291 29 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG No data
927186278_927186285 -9 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186285 2:20484835-20484857 GTGATGGTATTAGGAGGTAAGGG No data
927186278_927186290 28 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186290 2:20484872-20484894 TTCACTTAGATGGAGTCATGAGG No data
927186278_927186288 -2 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data
927186278_927186284 -10 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186284 2:20484834-20484856 TGTGATGGTATTAGGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927186278 Original CRISPR TACCATCACATTTTGGGTTA GGG (reversed) Intergenic