ID: 927186282

View in Genome Browser
Species Human (GRCh38)
Location 2:20484828-20484850
Sequence CTCCTAATACCATCACATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927186282_927186290 21 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186290 2:20484872-20484894 TTCACTTAGATGGAGTCATGAGG No data
927186282_927186291 22 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG No data
927186282_927186289 11 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186289 2:20484862-20484884 GGGAGCTGATTTCACTTAGATGG No data
927186282_927186288 -9 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data
927186282_927186287 -10 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186287 2:20484841-20484863 GTATTAGGAGGTAAGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927186282 Original CRISPR CTCCTAATACCATCACATTT TGG (reversed) Intergenic