ID: 927186285

View in Genome Browser
Species Human (GRCh38)
Location 2:20484835-20484857
Sequence GTGATGGTATTAGGAGGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927186276_927186285 11 Left 927186276 2:20484801-20484823 CCAAAATTCATGTGTTGAAACCC No data
Right 927186285 2:20484835-20484857 GTGATGGTATTAGGAGGTAAGGG No data
927186275_927186285 12 Left 927186275 2:20484800-20484822 CCCAAAATTCATGTGTTGAAACC No data
Right 927186285 2:20484835-20484857 GTGATGGTATTAGGAGGTAAGGG No data
927186279_927186285 -10 Left 927186279 2:20484822-20484844 CCTAACCCAAAATGTGATGGTAT No data
Right 927186285 2:20484835-20484857 GTGATGGTATTAGGAGGTAAGGG No data
927186278_927186285 -9 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186285 2:20484835-20484857 GTGATGGTATTAGGAGGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927186285 Original CRISPR GTGATGGTATTAGGAGGTAA GGG Intergenic