ID: 927186288

View in Genome Browser
Species Human (GRCh38)
Location 2:20484842-20484864
Sequence TATTAGGAGGTAAGGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927186276_927186288 18 Left 927186276 2:20484801-20484823 CCAAAATTCATGTGTTGAAACCC No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data
927186282_927186288 -9 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data
927186279_927186288 -3 Left 927186279 2:20484822-20484844 CCTAACCCAAAATGTGATGGTAT No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data
927186275_927186288 19 Left 927186275 2:20484800-20484822 CCCAAAATTCATGTGTTGAAACC No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data
927186278_927186288 -2 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data
927186281_927186288 -8 Left 927186281 2:20484827-20484849 CCCAAAATGTGATGGTATTAGGA No data
Right 927186288 2:20484842-20484864 TATTAGGAGGTAAGGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927186288 Original CRISPR TATTAGGAGGTAAGGGCTTG GGG Intergenic