ID: 927186290

View in Genome Browser
Species Human (GRCh38)
Location 2:20484872-20484894
Sequence TTCACTTAGATGGAGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927186281_927186290 22 Left 927186281 2:20484827-20484849 CCCAAAATGTGATGGTATTAGGA No data
Right 927186290 2:20484872-20484894 TTCACTTAGATGGAGTCATGAGG No data
927186278_927186290 28 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186290 2:20484872-20484894 TTCACTTAGATGGAGTCATGAGG No data
927186279_927186290 27 Left 927186279 2:20484822-20484844 CCTAACCCAAAATGTGATGGTAT No data
Right 927186290 2:20484872-20484894 TTCACTTAGATGGAGTCATGAGG No data
927186282_927186290 21 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186290 2:20484872-20484894 TTCACTTAGATGGAGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927186290 Original CRISPR TTCACTTAGATGGAGTCATG AGG Intergenic