ID: 927186291

View in Genome Browser
Species Human (GRCh38)
Location 2:20484873-20484895
Sequence TCACTTAGATGGAGTCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927186279_927186291 28 Left 927186279 2:20484822-20484844 CCTAACCCAAAATGTGATGGTAT No data
Right 927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG No data
927186282_927186291 22 Left 927186282 2:20484828-20484850 CCAAAATGTGATGGTATTAGGAG No data
Right 927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG No data
927186281_927186291 23 Left 927186281 2:20484827-20484849 CCCAAAATGTGATGGTATTAGGA No data
Right 927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG No data
927186278_927186291 29 Left 927186278 2:20484821-20484843 CCCTAACCCAAAATGTGATGGTA No data
Right 927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927186291 Original CRISPR TCACTTAGATGGAGTCATGA GGG Intergenic