ID: 927192087

View in Genome Browser
Species Human (GRCh38)
Location 2:20523908-20523930
Sequence GGTCTGGCTCACCAGAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927192087_927192094 -2 Left 927192087 2:20523908-20523930 CCTAACTTCTGGTGAGCCAGACC No data
Right 927192094 2:20523929-20523951 CCCACTGGGGCCAGGAGAGTTGG No data
927192087_927192091 -10 Left 927192087 2:20523908-20523930 CCTAACTTCTGGTGAGCCAGACC No data
Right 927192091 2:20523921-20523943 GAGCCAGACCCACTGGGGCCAGG No data
927192087_927192098 21 Left 927192087 2:20523908-20523930 CCTAACTTCTGGTGAGCCAGACC No data
Right 927192098 2:20523952-20523974 TGCAAAGATCCTTCAGCGGAAGG No data
927192087_927192097 17 Left 927192087 2:20523908-20523930 CCTAACTTCTGGTGAGCCAGACC No data
Right 927192097 2:20523948-20523970 TTGGTGCAAAGATCCTTCAGCGG No data
927192087_927192100 27 Left 927192087 2:20523908-20523930 CCTAACTTCTGGTGAGCCAGACC No data
Right 927192100 2:20523958-20523980 GATCCTTCAGCGGAAGGTCAGGG No data
927192087_927192099 26 Left 927192087 2:20523908-20523930 CCTAACTTCTGGTGAGCCAGACC No data
Right 927192099 2:20523957-20523979 AGATCCTTCAGCGGAAGGTCAGG No data
927192087_927192101 28 Left 927192087 2:20523908-20523930 CCTAACTTCTGGTGAGCCAGACC No data
Right 927192101 2:20523959-20523981 ATCCTTCAGCGGAAGGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927192087 Original CRISPR GGTCTGGCTCACCAGAAGTT AGG (reversed) Intergenic
No off target data available for this crispr