ID: 927192092

View in Genome Browser
Species Human (GRCh38)
Location 2:20523924-20523946
Sequence TCTCCTGGCCCCAGTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927192092_927192099 10 Left 927192092 2:20523924-20523946 CCAGACCCACTGGGGCCAGGAGA No data
Right 927192099 2:20523957-20523979 AGATCCTTCAGCGGAAGGTCAGG No data
927192092_927192097 1 Left 927192092 2:20523924-20523946 CCAGACCCACTGGGGCCAGGAGA No data
Right 927192097 2:20523948-20523970 TTGGTGCAAAGATCCTTCAGCGG No data
927192092_927192103 18 Left 927192092 2:20523924-20523946 CCAGACCCACTGGGGCCAGGAGA No data
Right 927192103 2:20523965-20523987 CAGCGGAAGGTCAGGGGTTCTGG No data
927192092_927192100 11 Left 927192092 2:20523924-20523946 CCAGACCCACTGGGGCCAGGAGA No data
Right 927192100 2:20523958-20523980 GATCCTTCAGCGGAAGGTCAGGG No data
927192092_927192098 5 Left 927192092 2:20523924-20523946 CCAGACCCACTGGGGCCAGGAGA No data
Right 927192098 2:20523952-20523974 TGCAAAGATCCTTCAGCGGAAGG No data
927192092_927192104 30 Left 927192092 2:20523924-20523946 CCAGACCCACTGGGGCCAGGAGA No data
Right 927192104 2:20523977-20523999 AGGGGTTCTGGAGTGAGTCTTGG No data
927192092_927192101 12 Left 927192092 2:20523924-20523946 CCAGACCCACTGGGGCCAGGAGA No data
Right 927192101 2:20523959-20523981 ATCCTTCAGCGGAAGGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927192092 Original CRISPR TCTCCTGGCCCCAGTGGGTC TGG (reversed) Intergenic
No off target data available for this crispr