ID: 927195306

View in Genome Browser
Species Human (GRCh38)
Location 2:20542582-20542604
Sequence GACACAGATGTGTCCAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927195303_927195306 5 Left 927195303 2:20542554-20542576 CCTCTGGGTCTATCAGGGACACG No data
Right 927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG No data
927195296_927195306 24 Left 927195296 2:20542535-20542557 CCTCCCTATGGCATCTGTACCTC No data
Right 927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG No data
927195297_927195306 21 Left 927195297 2:20542538-20542560 CCCTATGGCATCTGTACCTCTGG No data
Right 927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG No data
927195299_927195306 20 Left 927195299 2:20542539-20542561 CCTATGGCATCTGTACCTCTGGG No data
Right 927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927195306 Original CRISPR GACACAGATGTGTCCAAACC TGG Intergenic
No off target data available for this crispr