ID: 927198345

View in Genome Browser
Species Human (GRCh38)
Location 2:20563416-20563438
Sequence AGGCTGGGCCCTCATTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927198345_927198357 7 Left 927198345 2:20563416-20563438 CCCCAGCAATGAGGGCCCAGCCT 0: 1
1: 0
2: 4
3: 17
4: 211
Right 927198357 2:20563446-20563468 GCAATGAGCTGTGGTCTGATGGG 0: 1
1: 0
2: 5
3: 37
4: 183
927198345_927198356 6 Left 927198345 2:20563416-20563438 CCCCAGCAATGAGGGCCCAGCCT 0: 1
1: 0
2: 4
3: 17
4: 211
Right 927198356 2:20563445-20563467 TGCAATGAGCTGTGGTCTGATGG 0: 1
1: 0
2: 1
3: 28
4: 226
927198345_927198359 18 Left 927198345 2:20563416-20563438 CCCCAGCAATGAGGGCCCAGCCT 0: 1
1: 0
2: 4
3: 17
4: 211
Right 927198359 2:20563457-20563479 TGGTCTGATGGGGCCACTACTGG 0: 1
1: 0
2: 0
3: 8
4: 103
927198345_927198358 8 Left 927198345 2:20563416-20563438 CCCCAGCAATGAGGGCCCAGCCT 0: 1
1: 0
2: 4
3: 17
4: 211
Right 927198358 2:20563447-20563469 CAATGAGCTGTGGTCTGATGGGG 0: 1
1: 0
2: 3
3: 14
4: 182
927198345_927198352 -2 Left 927198345 2:20563416-20563438 CCCCAGCAATGAGGGCCCAGCCT 0: 1
1: 0
2: 4
3: 17
4: 211
Right 927198352 2:20563437-20563459 CTGGCCCCTGCAATGAGCTGTGG 0: 1
1: 0
2: 2
3: 25
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927198345 Original CRISPR AGGCTGGGCCCTCATTGCTG GGG (reversed) Intronic
900482818 1:2907601-2907623 AGGCTGGGCCCTCACTGTCCCGG + Intergenic
902471380 1:16649172-16649194 AGGCAGGGCCAGCATTTCTGCGG + Intergenic
903780262 1:25816145-25816167 AGCCTGGCCCCTCCTGGCTGGGG - Exonic
904302849 1:29566603-29566625 AGGTTTGGCCTGCATTGCTGGGG + Intergenic
904390359 1:30181250-30181272 AGGCTGGGCCCACATATCTGGGG - Intergenic
904438219 1:30513080-30513102 CGGCAGGGACCACATTGCTGTGG + Intergenic
904567656 1:31437282-31437304 AGCATGGGCCCTCAGGGCTGAGG - Intergenic
905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG + Intergenic
906184523 1:43851403-43851425 AAGCTGGACCCACAGTGCTGGGG - Intronic
906531119 1:46524648-46524670 ATGCTGGGTCCTCCTGGCTGGGG + Intergenic
908136926 1:61142861-61142883 GGGATGGACCCTCCTTGCTGTGG + Intronic
910114430 1:83716690-83716712 AGGCTGGGCCTCCAAAGCTGAGG + Intergenic
915525968 1:156476464-156476486 AGGCTGTGAGCTCTTTGCTGTGG - Intronic
916436165 1:164779927-164779949 AGGCTGGGCCTTATTTACTGTGG - Intronic
918206585 1:182314956-182314978 AGGCCCTGCCCCCATTGCTGTGG - Intergenic
918465631 1:184818809-184818831 CGGCTGGGCCACCATCGCTGAGG + Exonic
919389374 1:196963166-196963188 ATGCTGGTCCATCATTCCTGTGG - Intergenic
920297756 1:204969432-204969454 CGGGTGGGCCCTCTTTGCTTTGG - Intronic
921905079 1:220487500-220487522 AAGCTGGGCCCTCAGAGATGTGG - Intergenic
924469605 1:244330161-244330183 AGGATGGGGACTCATTGCTAAGG + Intergenic
1064251203 10:13707678-13707700 AGGCTGGGACCTTATTTCGGGGG + Intronic
1065492319 10:26294217-26294239 AGGCTGTCCCCTCACTGCTCAGG + Intronic
1065650927 10:27890323-27890345 ATGCTGGGCACTCTTGGCTGAGG + Intronic
1065751407 10:28890986-28891008 AGGCAGGGCCCTGAGAGCTGAGG + Intergenic
1066709365 10:38216708-38216730 AGGGGGGCCCGTCATTGCTGAGG + Intergenic
1067789879 10:49279761-49279783 AGGCTGTGACCTGGTTGCTGGGG + Intergenic
1067904668 10:50278364-50278386 AGGCTGGGCTCTGAAAGCTGGGG - Intergenic
1069663583 10:70139829-70139851 GGGCTGGGCCCTGAATCCTGAGG + Exonic
1069958043 10:72063527-72063549 AGGCTGGGCCTTCCTAGCAGGGG - Intronic
1071140782 10:82507145-82507167 ATGCTGGGCCCTGACAGCTGAGG + Intronic
1072100148 10:92221674-92221696 AGGCTCTGCCCTCATTAATGGGG + Intronic
1074433019 10:113409422-113409444 TGGCTGGGCCAGCACTGCTGTGG + Intergenic
1076404150 10:130201235-130201257 AGGCAGGGCCTCCATGGCTGGGG + Intergenic
1076661627 10:132059474-132059496 CGGCTGGGTCATCCTTGCTGTGG - Intergenic
1076687313 10:132203984-132204006 AGGCTGGGCCCTGGTACCTGAGG - Intronic
1077296565 11:1829222-1829244 AGCCTGGTGCCTCATTCCTGTGG - Intronic
1079104738 11:17563345-17563367 ATTCAGGGCCCTCAGTGCTGGGG - Intronic
1080634165 11:34108782-34108804 AGGCTCGGCCTTCAGTGCTGTGG + Exonic
1081340862 11:41925897-41925919 ATGCTGTGCCCTAATTGTTGTGG - Intergenic
1081606171 11:44528338-44528360 AGCCTGAGCCCTCATTCTTGAGG + Intergenic
1082244285 11:49904058-49904080 AGGTTAGGTCCTCCTTGCTGAGG - Intergenic
1082565979 11:54677998-54678020 AGGTTAGGTCCTCCTTGCTGAGG + Intergenic
1083274270 11:61587962-61587984 AGGGTGGGGCCTCAATCCTGGGG - Intergenic
1083516630 11:63265033-63265055 AGGCAGGACCCGCATAGCTGAGG - Intronic
1083739136 11:64698689-64698711 AGGCAGGGCCCTAATAGGTGAGG - Intronic
1083934862 11:65864926-65864948 AGGCTGGCCCCCCAAGGCTGAGG + Intronic
1084272572 11:68037040-68037062 AGGCCGGGGCATCCTTGCTGGGG + Intergenic
1084391008 11:68876901-68876923 AGGATGGGGACTCCTTGCTGGGG - Intergenic
1087188598 11:95230348-95230370 AACCTGGCCCCTCTTTGCTGTGG - Intronic
1089307753 11:117537359-117537381 AGGCGTGGCCGTCAGTGCTGGGG + Intronic
1089392480 11:118111632-118111654 AAGCAGGGCCCTTATGGCTGGGG - Intronic
1090235749 11:125145549-125145571 AGGGTGAGGCCTCAGTGCTGGGG - Intergenic
1098878374 12:75890984-75891006 AGCCTGGGCCCTGAATGCTGAGG - Intergenic
1100599260 12:96098902-96098924 AGGACTGGCCCTCGTTGCTGGGG - Intergenic
1100885588 12:99066409-99066431 ATGCTGGACCCTCCTTCCTGAGG - Intronic
1101816427 12:108149556-108149578 AGGCTGAGCCTTCAGTGCTCAGG + Intronic
1102406201 12:112676328-112676350 AGGCTGTGTGCTCATTTCTGAGG + Intronic
1103336551 12:120194520-120194542 AGGCTGGACTCTCAGGGCTGCGG - Intronic
1104044656 12:125153360-125153382 AGGCTGGGCCCACATTCCTTGGG + Intergenic
1105701531 13:22938825-22938847 CGGGTGGGCCGTCAGTGCTGAGG + Intergenic
1106738934 13:32618141-32618163 AGGCTGGGGCCTGAGTGCTTAGG - Intronic
1108934313 13:55866964-55866986 AGTCTGAGCCATTATTGCTGGGG + Intergenic
1109007771 13:56900902-56900924 TGGCTGGGCCAGCACTGCTGGGG - Intergenic
1113468039 13:110525689-110525711 CGGCTCGGCCCTCCCTGCTGGGG - Intronic
1114512034 14:23270246-23270268 ATGCTGGGCGCTCAGTTCTGAGG + Intronic
1118170688 14:63385774-63385796 AGACTGGGGCCTCATTTCTAGGG + Intronic
1118325367 14:64776989-64777011 AGGCTGGGCCTTCCTCCCTGGGG + Intronic
1119760397 14:77146675-77146697 AGCCTGGGCCATCTCTGCTGGGG - Intronic
1120755013 14:88234680-88234702 ATGCCTGTCCCTCATTGCTGTGG + Intronic
1121931932 14:97980024-97980046 AGCCTGGGTCTTCATGGCTGTGG - Intergenic
1122455519 14:101847635-101847657 AGGCTGTGTCCTCATGGTTGGGG + Intronic
1123113437 14:105883331-105883353 AGGCTGGCCACTCAGTGATGGGG + Intergenic
1124492624 15:30167481-30167503 AGGCAGGGCTCCCATGGCTGTGG + Intergenic
1124750910 15:32370844-32370866 AGGCAGGGCTCCCATGGCTGTGG - Intergenic
1125419202 15:39487348-39487370 TGTCTGGGCCCTCATCACTGAGG + Intergenic
1125533470 15:40428938-40428960 GGGCTGGGTCCTCATTACTGAGG - Intronic
1125631844 15:41153734-41153756 AGGCAAGGTCCTCATTGCTTTGG - Intergenic
1126165183 15:45648899-45648921 AGGCTGGGCCCACTCTGCTTTGG - Intronic
1126360689 15:47842737-47842759 AGGCAGGGCCCTCATGATTGGGG + Intergenic
1127077710 15:55344263-55344285 AGGCTGGGCTCTCATGTCTGGGG + Intronic
1127541660 15:59945051-59945073 AGGCTGGTCCCTCTTTGCTGTGG + Intergenic
1128498323 15:68210679-68210701 AGGCTGAGACCACATTTCTGAGG + Intronic
1128684028 15:69670723-69670745 AGGCTGGGTCATAGTTGCTGGGG - Intergenic
1129194575 15:73956228-73956250 AGCCTGGGCCCTCCCTGCAGGGG - Intergenic
1129599926 15:76992849-76992871 AGGCTGGCCTCTCATTCCTATGG + Intergenic
1129714012 15:77836519-77836541 AGGCTGCCTCCTCACTGCTGAGG - Intergenic
1132810488 16:1794513-1794535 TGGCTGGGCACACATTCCTGTGG - Intronic
1132915480 16:2341384-2341406 AGGCCGGGCCCTCCTGCCTGAGG - Intergenic
1134292947 16:12917809-12917831 AGACTGGGTCGTCTTTGCTGAGG + Intronic
1136639223 16:31547681-31547703 AGGCTGGGCTCTGCTTGCTGTGG + Intergenic
1136665445 16:31807960-31807982 AGGCTGGGCTCTGCCTGCTGTGG - Intergenic
1137236831 16:46624216-46624238 AGGCTGGGGCCTCACAGGTGGGG - Intergenic
1137476067 16:48811075-48811097 AGGCGGGGGCCTCAGTGCGGGGG - Intergenic
1137560372 16:49498459-49498481 AGGCGGGGGCCTTATTGATGAGG + Intronic
1137566389 16:49535169-49535191 AGGCTGGGCCCCGATCTCTGCGG - Intronic
1138340432 16:56285557-56285579 AGGCAGGCCCCTCTCTGCTGTGG - Intronic
1138492006 16:57382442-57382464 AGGCTGGGCCCAGGTTGGTGGGG - Exonic
1138536666 16:57663891-57663913 GGGCCCAGCCCTCATTGCTGGGG + Exonic
1139949070 16:70660499-70660521 CAGCTGTGCCCTCACTGCTGCGG - Exonic
1143047662 17:4095114-4095136 GGGCAGGTCCCGCATTGCTGAGG - Intronic
1143178351 17:4969136-4969158 GGGCTGGGCCCTACTTGTTGCGG + Exonic
1144462412 17:15468778-15468800 AGGCAGAGCCCTCATTGCTGCGG + Intronic
1144867865 17:18348348-18348370 AAGCTGGACCCACAGTGCTGGGG - Exonic
1147554468 17:41467610-41467632 TGCCTGGGCCCTCATTACTAGGG + Intergenic
1148075105 17:44931257-44931279 TGGCTGTCCCCTCCTTGCTGTGG + Intronic
1151396596 17:73827006-73827028 AGGCTGGGCTGTCACTGATGTGG + Intergenic
1151625291 17:75272121-75272143 TGTCTGGGCCCTGAATGCTGGGG - Intergenic
1152030880 17:77842280-77842302 AGGCTGGGCACTCAGTGCTGGGG - Intergenic
1152339368 17:79715866-79715888 TTGCTGTCCCCTCATTGCTGGGG - Intergenic
1152625232 17:81385087-81385109 GGTCTGGCACCTCATTGCTGGGG - Intergenic
1153565989 18:6417741-6417763 AGGCTGGTCTCAAATTGCTGGGG + Intergenic
1153979540 18:10297377-10297399 AGCCTGGGCCCTCGGTGATGTGG + Intergenic
1154027833 18:10724778-10724800 AGGCTGGGGCTGCAGTGCTGGGG - Intronic
1154254619 18:12771655-12771677 AGGCTGGGCACAGAGTGCTGAGG + Intergenic
1155218279 18:23662468-23662490 AGGCTTCGCACTCATGGCTGTGG - Intronic
1157279629 18:46337532-46337554 AGGCTGGGCCCACCATGCTTCGG - Intronic
1157308847 18:46536885-46536907 AGGCTGGGCCCTCCAGGCAGTGG - Intronic
1157913239 18:51639164-51639186 AAGCTAGGCCCTGATGGCTGGGG - Intergenic
1158317209 18:56224604-56224626 ATGCTGGGGGCTCTTTGCTGTGG - Intergenic
1160801544 19:972444-972466 AGGATCGGCCCACACTGCTGTGG - Exonic
1160811130 19:1013379-1013401 AGGCTGGGCCCTCACAGCCCGGG - Intronic
1163454747 19:17399908-17399930 AGGGTGGGCCTTCACTTCTGTGG - Intergenic
1165232473 19:34395713-34395735 AGGCTGTGTCCTCACTGGTGTGG + Intronic
1165372154 19:35415343-35415365 AGGCTGGTCCCTCTCTTCTGGGG + Intergenic
1167208971 19:48121365-48121387 AGGCGGGGCCCTCACTGCTGGGG + Intronic
1167473101 19:49686247-49686269 AGGCGGGGCCCACAGGGCTGGGG + Intronic
1167617437 19:50543163-50543185 AGGCTCGGCCCTAGGTGCTGGGG + Intronic
1168059532 19:53883239-53883261 AGGCTGGGGCCCCACAGCTGAGG + Intronic
1168311607 19:55463614-55463636 AGGCAGGTCCCACATTTCTGCGG - Intergenic
1202653051 1_KI270707v1_random:23992-24014 TAGCTGTGCCCACATTGCTGAGG - Intergenic
925178999 2:1804498-1804520 TGGCTGGGCCCTCCCTGCTCAGG - Intronic
925357807 2:3254487-3254509 TGGCTGGTTCCTCTTTGCTGCGG - Intronic
926322863 2:11760817-11760839 GGGTTGGGGCCTCACTGCTGGGG + Intronic
927013664 2:18933053-18933075 TGGCTGGACTCTCATTGCTTTGG - Intergenic
927198345 2:20563416-20563438 AGGCTGGGCCCTCATTGCTGGGG - Intronic
927437319 2:23077993-23078015 AGAACTGGCCCTCATTGCTGTGG - Intergenic
928178778 2:29053140-29053162 AGGCTGGGCCCTCAGGGCCTCGG - Exonic
930761554 2:55043982-55044004 AGGCTGGGCTCAAATTCCTGAGG - Intronic
934678584 2:96266515-96266537 AGGCTGAGCCCTCAGCGCTGAGG - Intronic
935677643 2:105609648-105609670 AGACTGGGCCCTCTCTGTTGTGG + Intergenic
937114735 2:119397186-119397208 GGGCCTGGCCCTCAGTGCTGGGG - Intergenic
937152547 2:119695940-119695962 AGGCTGGGCCATGCTTGCAGTGG - Intergenic
937250633 2:120521655-120521677 GGGCTGGGCCCTGGCTGCTGGGG + Intergenic
937320368 2:120957141-120957163 AGGCTGGCCCCTCATGGATATGG + Intronic
937442781 2:121931207-121931229 GGGCTGGGCCCAAATTCCTGGGG + Intergenic
939417140 2:141914063-141914085 AGGCTGTGCCCTCCTTGGTAAGG - Intronic
940796089 2:158080751-158080773 AGACTGTGCCCTCATTAGTGTGG + Intronic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
942760778 2:179394809-179394831 AGGATGGGCCCTTATGGCTAAGG + Intergenic
948488567 2:238296941-238296963 AGGCAGGGCCCTCCTCGCGGGGG + Intergenic
948598122 2:239093400-239093422 AGGCTGGCCCCTCCTGGCTCTGG + Intronic
1171253001 20:23663536-23663558 GGGCTGGGGTCTCAGTGCTGAGG + Intergenic
1171259488 20:23718854-23718876 GGGCTGGGGTCTCAGTGCTGAGG + Intergenic
1176112905 20:63418595-63418617 AGGCTGGTCCCTCAGGGCAGGGG - Intronic
1179567152 21:42256317-42256339 AGGGTGGGCCCTCTCTGCTGGGG + Intronic
1180864210 22:19106550-19106572 ACTCTGGGCCCTCATGGGTGAGG - Intronic
1181185861 22:21103162-21103184 TGTCTGGGCCCTGAGTGCTGAGG + Intergenic
1182136903 22:27914028-27914050 AGGCTGGAGCCTCATTTCTCTGG + Intronic
1183408884 22:37643480-37643502 AGGCTGGGCCATGAGTGCTCTGG - Intronic
1183451643 22:37899113-37899135 GGGCAGGGCCCTGATTCCTGGGG + Intergenic
1183792857 22:40087824-40087846 AGGCAGGGCCCTCATCACAGAGG + Intronic
1184606003 22:45575279-45575301 AGGCTGGGTCCTGAGTGGTGAGG + Intronic
950073590 3:10171476-10171498 AGGCTGTGCCATCCCTGCTGTGG + Intronic
950199900 3:11035462-11035484 AGGCAGGTGCCTCATTGATGAGG + Intronic
953227712 3:41035507-41035529 AGTCTGTGCCCAGATTGCTGGGG - Intergenic
954297997 3:49684810-49684832 AGGCTTGGCTCTCCATGCTGTGG + Exonic
954298051 3:49685069-49685091 AGGCAGGGCCAGCATTTCTGCGG - Exonic
954491941 3:50915075-50915097 ACTCTGGGCCCACATTGCTAAGG - Intronic
955512055 3:59691197-59691219 ATGCTGGGGGCTCATTTCTGTGG - Intergenic
957701888 3:83725996-83726018 AGGCTGGGCCCTCAGTCCTTGGG + Intergenic
959217633 3:103472960-103472982 AGGCTGGTCTCTAATTGTTGAGG - Intergenic
959865634 3:111266838-111266860 TGGATGGACTCTCATTGCTGAGG - Intronic
961559517 3:127719014-127719036 AAGCTGGGCCCTCAAGTCTGGGG + Intronic
961603231 3:128076401-128076423 AGGCGGGGCCGGCATTCCTGCGG + Intronic
961749950 3:129088913-129088935 AGGCTGGGGCCTCACAGGTGGGG - Exonic
962232929 3:133681653-133681675 AGGGGCGCCCCTCATTGCTGAGG + Intergenic
967569878 3:191016134-191016156 AGGGGCGGCCCCCATTGCTGAGG - Intergenic
968624658 4:1621714-1621736 AGGCTGGGGTCTCAGAGCTGGGG - Intronic
968884575 4:3320847-3320869 AGGTGGGGCCCTGATCGCTGCGG - Intronic
974950378 4:68578675-68578697 AGGCTGTGCCCTCTCTGCGGAGG + Intronic
979531434 4:121772787-121772809 AGGCTGGGAACTCATGGCCGTGG + Intergenic
980595428 4:134948338-134948360 AGGGTGGGCCAGCAGTGCTGGGG + Intergenic
985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG + Intronic
988834035 5:35014079-35014101 AGGTTGGGCTCTCACTTCTGGGG - Exonic
989648175 5:43659242-43659264 AGGCTGGGCCCTGTGTGCAGAGG + Exonic
991017240 5:61945294-61945316 AGGCTGGGGCTTGATTGATGTGG - Intergenic
991432362 5:66561608-66561630 AGGCAGAGCCCTCATTAATGGGG + Intergenic
997333574 5:133086123-133086145 AGCCTGGGAACTCACTGCTGAGG + Intronic
997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG + Intronic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
1001712310 5:173788801-173788823 AGCCTGGGTCCTTAGTGCTGGGG + Intergenic
1001873566 5:175179834-175179856 TGTCTGGGCCTTCATTCCTGTGG + Intergenic
1002180365 5:177428084-177428106 AGGCTGGGTCCTCATTGCCTGGG + Intronic
1002291163 5:178201989-178202011 AGCCCTGGCCCTCATTTCTGTGG + Intergenic
1003515611 6:6816047-6816069 ACGCAGGGCCCACAGTGCTGTGG + Intergenic
1005738731 6:28772149-28772171 AGGCTGGCCCCTCACTGTAGCGG + Intergenic
1005989350 6:30893414-30893436 CGGCTGTGCCCACCTTGCTGAGG - Exonic
1006104878 6:31710494-31710516 GGGATGGGCCCTCGTTCCTGAGG + Intronic
1006441247 6:34054922-34054944 AGGCTGAGCCCTCATGGGTGGGG - Intronic
1013438584 6:110138842-110138864 GGGCTGGGCTCTCAGTTCTGTGG - Intronic
1018919341 6:168160704-168160726 AGGCTGGGCCATCTTGGGTGAGG + Intergenic
1019572720 7:1720426-1720448 AGGCTGGGGACCCATTCCTGAGG - Intronic
1019638700 7:2090771-2090793 GGGCGGGGCCCTCATCGCTCCGG + Intronic
1020021533 7:4872325-4872347 AGGTTGGGGCATCTTTGCTGAGG - Intronic
1022592708 7:31680990-31681012 AGGCTGGTCCCTACTTCCTGAGG - Intergenic
1023735861 7:43235287-43235309 AGGTTTGGCCCTCCTTGATGGGG + Intronic
1023759154 7:43447621-43447643 AGCCTGGGGACTCACTGCTGAGG - Intronic
1024544887 7:50508803-50508825 AGTCTGGGCCCTCATAGGAGAGG - Intronic
1024584679 7:50831977-50831999 TGGCTTGGCCATCATTGCTGAGG - Intergenic
1029366454 7:100119582-100119604 AGGGTGGGGCCTCGTTGCTACGG - Intronic
1032791846 7:135248167-135248189 AGGCTTGGGCCTGATAGCTGAGG - Intronic
1033735609 7:144218676-144218698 AGGTAGGATCCTCATTGCTGTGG + Intergenic
1033747445 7:144332294-144332316 AGGTAGGATCCTCATTGCTGTGG - Intergenic
1035743190 8:1944269-1944291 AGGCTGGGCACGCAGGGCTGGGG - Intronic
1035979207 8:4350500-4350522 AGGCTGAGAGCTCACTGCTGCGG - Intronic
1037805145 8:22054777-22054799 AGGGTGGGTCCTCAGTGCTGGGG - Intronic
1045510706 8:102810417-102810439 AGGCCGGGCTCTCCCTGCTGCGG + Intergenic
1048572743 8:135668911-135668933 AGGCTGTGCCCCCTTTTCTGGGG + Intergenic
1049220436 8:141426422-141426444 AGACAGGGCCCACATTTCTGAGG - Intronic
1055641081 9:78319493-78319515 AGGCTGGGGGCTCAGTGCTGGGG + Intronic
1057783635 9:98070887-98070909 AGCCTGGGCCGTCAAGGCTGCGG - Intronic
1059610268 9:115884668-115884690 AAGCTGGACCCTGATTTCTGTGG - Intergenic
1060214873 9:121732701-121732723 AGGCTGGGGCCAGATTGTTGAGG + Intronic
1061484633 9:130914144-130914166 AGGCCTGGGCCTCAGTGCTGTGG - Intronic
1062718267 9:138022129-138022151 AGGCTCGGCCCTCACTGCATGGG - Intronic
1185484889 X:474737-474759 AGGCTGGGCCCTAAATGCAATGG - Intergenic
1186600237 X:11028875-11028897 AGGCTGGGAGCTCATGGCAGGGG + Intergenic
1190597094 X:52061305-52061327 AGGAGGGGCCGTGATTGCTGAGG - Intergenic
1190611730 X:52192768-52192790 AGGAGGGGCCGTGATTGCTGAGG + Intergenic
1192270823 X:69577790-69577812 AGCCTGGCCCCTCTTTGCTGAGG + Intergenic
1199522835 X:148755994-148756016 AGGCTGGGCCCACATCATTGTGG + Intronic
1200078450 X:153563737-153563759 AGGCTGGTGCCACATTCCTGGGG - Intronic
1202047247 Y:20747579-20747601 TGCCTGGCCCCTCATTGCAGGGG - Intergenic