ID: 927199134

View in Genome Browser
Species Human (GRCh38)
Location 2:20567739-20567761
Sequence GGGTGAAAGGGCAAGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927199134_927199145 12 Left 927199134 2:20567739-20567761 CCTGTGACCTTGCCCTTTCACCC 0: 1
1: 0
2: 3
3: 23
4: 266
Right 927199145 2:20567774-20567796 GTAGCTGAGCTTCCCTCCTTAGG 0: 1
1: 0
2: 0
3: 15
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927199134 Original CRISPR GGGTGAAAGGGCAAGGTCAC AGG (reversed) Intronic
900432489 1:2609458-2609480 GGCTGCAGGGGCCAGGTCACAGG + Intronic
900584231 1:3424769-3424791 GGGTGGAGGAGGAAGGTCACAGG + Intronic
900646818 1:3712852-3712874 GGCTGCAAGGGCAAGGTTAGGGG - Intronic
902783054 1:18716846-18716868 GGGGGAGAGGGCAAGGGCAAGGG - Intronic
902986111 1:20155288-20155310 TGGTAAAAGGGGGAGGTCACTGG - Intergenic
904806127 1:33133673-33133695 GGGTGTTAGGGCAAGGGCAGTGG + Intergenic
905873792 1:41419417-41419439 GGCTGAGCCGGCAAGGTCACTGG + Intergenic
906108694 1:43309354-43309376 GGGGGAAGGGGACAGGTCACAGG - Intronic
908668918 1:66523878-66523900 GGGTGAATGGGCAAAGTGATAGG - Intergenic
910113679 1:83709260-83709282 GGGTGAACAGGCAAGGTGGCAGG + Intergenic
911445633 1:97988160-97988182 GGGAGAGAGGGCAAGCTCTCTGG + Intergenic
912132512 1:106619863-106619885 GGGTGGAAGGGGATGGTCCCTGG + Intergenic
913353565 1:117891303-117891325 GAGTGAAAGTGCTAGGTTACAGG + Intronic
915343359 1:155188067-155188089 GGGTGAGAGGGAAAGGACTCAGG + Intronic
916105154 1:161424245-161424267 GGGGGATTTGGCAAGGTCACAGG - Intergenic
918427531 1:184425715-184425737 GCTTGAAAGGGCAAGGTCAGAGG + Intronic
922059532 1:222074518-222074540 GGGAGCTAGGGCAAGGACACAGG - Intergenic
922449442 1:225725033-225725055 GGGTGAGGGGGCCAGGTCACTGG - Intergenic
922722543 1:227906198-227906220 TGGTGACAGGGCCAGGCCACAGG - Intergenic
923271455 1:232358756-232358778 GGGATGAAGGACAAGGTCACTGG + Intergenic
1063121233 10:3106720-3106742 GGGTGAAGGGGCAGGGGCAGGGG - Intronic
1063561564 10:7133131-7133153 TGGTGAAAGGAACAGGTCACAGG - Intergenic
1065716733 10:28577601-28577623 TGATGAAAGGCCAAGGACACTGG + Intronic
1069737733 10:70668514-70668536 TGGAGACAGGGCAAGATCACAGG - Intergenic
1070755155 10:78987553-78987575 GGGTGAGATGTCAAGGTGACTGG - Intergenic
1070794845 10:79210490-79210512 GGGAGAAGGGGCAAGGGTACAGG + Intronic
1071512249 10:86269429-86269451 GGGTGAAGGGGCAAGGGAGCTGG - Intronic
1073106708 10:101036459-101036481 GGGTGGAAAAGCCAGGTCACGGG - Intronic
1074087786 10:110221819-110221841 GGGAGAAAGGGAAAGGACATGGG - Intronic
1074854582 10:117464138-117464160 GGGAGAAAGGGCAAGGCCTTGGG + Intergenic
1075463906 10:122637200-122637222 GGTGGAAATGACAAGGTCACTGG - Exonic
1075982764 10:126755595-126755617 GGGTGAAATTCCCAGGTCACTGG + Intergenic
1076050484 10:127329414-127329436 GGGTGCTAGGGCAGGGTCTCTGG + Intronic
1076702257 10:132279958-132279980 GGGTGCAGGGGCGTGGTCACGGG - Intronic
1076702315 10:132280261-132280283 GGGTGCAGGGGCGTGGTCACGGG - Intronic
1076702377 10:132280564-132280586 GGGTGCAGGGGCGTGGTCACGGG - Intronic
1076702438 10:132280907-132280929 GAGTGCAGGGGCATGGTCACAGG - Intronic
1078139365 11:8681100-8681122 GGCTGTAAGGGCAAGGACATGGG + Intergenic
1078365827 11:10705530-10705552 GGGTGATAGGGAGAGGTCTCAGG + Intergenic
1078639163 11:13079362-13079384 GGGTGACAGGGAAAGGTGGCAGG + Intergenic
1081909342 11:46690669-46690691 GGGAGAGAGGGCGAGGACACAGG - Intronic
1082719136 11:56651961-56651983 GGGTGAAAGGGAAATGTAATAGG - Intergenic
1083203680 11:61134697-61134719 GGGTGAGAGAGCCAGGTCCCTGG + Intronic
1083609171 11:63997014-63997036 GGGAGAAAGGGCAAGATGACGGG - Intronic
1084534478 11:69748559-69748581 GGATGAAAGGGGAGGGTCAGGGG + Intergenic
1084871097 11:72099005-72099027 GGGGGATGGGACAAGGTCACTGG - Intronic
1086395773 11:86413459-86413481 TGGGGAAAGGGCATGGTCCCTGG - Intronic
1086776119 11:90834694-90834716 GAGTGAAAGGGCACTGTCATAGG + Intergenic
1087025081 11:93641747-93641769 GGGTGAAAGTGCAAGATGGCAGG - Intergenic
1087461487 11:98453778-98453800 GGGGTAAAGGGCATGGTCCCTGG - Intergenic
1088641731 11:111879327-111879349 GGGTGAAAGGGCGAGGTGACAGG - Exonic
1089709097 11:120302261-120302283 GGGTGAAAGGGGAGGGACAAAGG - Intronic
1090214640 11:124951040-124951062 GGGTTAAAGAACAAGATCACTGG - Intergenic
1090785889 11:130046915-130046937 GGGAGAAAGTGCAATGGCACTGG + Intergenic
1091704596 12:2685342-2685364 GGGTGAAAGTTGAGGGTCACTGG + Intronic
1091711166 12:2741679-2741701 GGGTGAAAGTTGAGGGTCACTGG + Intergenic
1093790711 12:23246066-23246088 TGGTGAAAGGGCAAAGAGACAGG - Intergenic
1096171591 12:49475992-49476014 GGGTGGAAGGGCATGGTCCCTGG + Intronic
1097033288 12:56104857-56104879 GGCTGATAGGGAAAGGTAACAGG + Intronic
1098002630 12:65961293-65961315 AAGTGAAAGGACAGGGTCACAGG + Intronic
1098889448 12:75994248-75994270 GAGTGACAAGGCAAGGACACAGG + Intergenic
1099894152 12:88623980-88624002 GGGGCAAAAGACAAGGTCACTGG + Intergenic
1104760921 12:131297170-131297192 GGGTGACCTGCCAAGGTCACAGG + Intergenic
1104818857 12:131663622-131663644 GGGTGACCTGCCAAGGTCACAGG - Intergenic
1105227638 13:18451278-18451300 CGGAGACAGGGCAAGATCACAGG + Intergenic
1105488592 13:20862985-20863007 TGGTGCTAGAGCAAGGTCACTGG - Intronic
1107341715 13:39414180-39414202 GGGTGAAATTGCCAGATCACAGG + Intronic
1108123795 13:47218643-47218665 GGGTGAAATTGCTGGGTCACAGG + Intergenic
1111667595 13:91288757-91288779 TGGTGAGAGGGCAAGAGCACAGG - Intergenic
1111972149 13:94927639-94927661 GGATGAGTGGGCATGGTCACTGG - Intergenic
1114035829 14:18626586-18626608 GGATGAAAGGGCAAGGGAACTGG + Intergenic
1114122809 14:19688436-19688458 GGATGAAAGGGCAAGGGAACTGG - Intergenic
1114216838 14:20663584-20663606 GGGTGAGAGGGCTCGGTCAGAGG + Intergenic
1115315723 14:32022928-32022950 AGGTGAAAGGCCGAGGTCACTGG + Intergenic
1117724953 14:58663876-58663898 GGGTGAAGGGGTGAGGTTACTGG - Intergenic
1118200117 14:63663706-63663728 GGTGGAAAGGGGAAGGTCCCTGG - Intergenic
1119907388 14:78318199-78318221 AGGTGAAAGGGGAAGGCCATTGG + Intronic
1122035532 14:98946570-98946592 GGATGAAAGGGGGAGGTCTCTGG + Intergenic
1123144860 14:106119002-106119024 GGGTGAAGGGGCTTGGACACAGG - Intergenic
1124156842 15:27233440-27233462 GGCTGGAAGGCCAAGGTCAGTGG + Intronic
1129411297 15:75352007-75352029 GGGTGCAAGGGGAAGGAAACTGG - Intronic
1129664517 15:77572079-77572101 GGGTCAAAGGGCAAGGAGAATGG + Intergenic
1129739059 15:77981157-77981179 GGGTGATGGGGCATGGCCACGGG + Intergenic
1130706887 15:86241610-86241632 AGGTGAAAGGGCAAGCTAGCAGG + Intronic
1131565492 15:93481754-93481776 GAGTCAAAAGGCAAGGTCAAAGG + Intergenic
1132674434 16:1115803-1115825 GGGTGAGAGGCCAAGGCCAGAGG + Intergenic
1132874620 16:2130801-2130823 GTGGGAAAGGGCAAGGCCCCGGG + Intronic
1133277153 16:4645877-4645899 TGGTGAATGGGCACAGTCACAGG + Intronic
1134006132 16:10819804-10819826 AGGGCAAAGGGCAGGGTCACTGG - Intergenic
1134380761 16:13723270-13723292 GTGTGCAATGGCTAGGTCACAGG - Intergenic
1136694336 16:32063977-32063999 GGGTGAAGGGGCTTGGACACAGG + Intergenic
1136794835 16:33007240-33007262 GGGTGAAGGGGCTTGGACACAGG + Intergenic
1136875073 16:33847145-33847167 GGGTGAAGGGGCTTGGACACAGG - Intergenic
1137063874 16:35816242-35816264 GGCAGAAATGGCAAGTTCACAGG - Intergenic
1138729991 16:59184023-59184045 GGCTGAAAAGTCAAGGTCAAGGG + Intergenic
1141316097 16:82963859-82963881 GGGAGCAATGGCAAGGGCACCGG + Intronic
1203097096 16_KI270728v1_random:1268891-1268913 GGGTGAAGGGGCTTGGACACAGG + Intergenic
1147393538 17:40123566-40123588 GGGTTAAAGGGCAACCTCTCAGG + Intronic
1148002431 17:44397710-44397732 GGGTGAAAGGTGAAGGGCCCAGG + Exonic
1148159422 17:45441612-45441634 GGGTGACAGGCCCAGGGCACAGG - Intronic
1148447493 17:47746386-47746408 GGGTGTGAGGGCAAGGCCAAGGG + Intergenic
1148766668 17:50043701-50043723 GGGAGACAGGGCAGGGTCCCAGG - Intergenic
1148863325 17:50615880-50615902 TGGAGAAGTGGCAAGGTCACAGG - Intronic
1149111580 17:53037900-53037922 GGCTGAAAGTCCAAGGTCAGGGG - Intergenic
1149275318 17:55027250-55027272 GGGTGGAGGGGCAAAGTCAGGGG - Intronic
1150390757 17:64788697-64788719 GGGTGACAGGCCCAGGGCACAGG - Intergenic
1151962084 17:77410897-77410919 TGAAGAAAGGGAAAGGTCACAGG - Intronic
1152649599 17:81486212-81486234 GGGGGAGAGGGCAAGGCCAGGGG - Intergenic
1152982983 18:296436-296458 GGGTGAAAGAGAAAGATCACAGG + Intergenic
1154145878 18:11865865-11865887 GGGTGACTGGGCAAGGTAAAGGG - Intronic
1154525744 18:15288198-15288220 CGGAGACAGGGCAAGATCACAGG - Intergenic
1155565197 18:27126786-27126808 TGGTGACAGGGCAAGGTCACGGG + Intronic
1155637910 18:27976893-27976915 GGCTGAAAGGGGATGGTCCCAGG + Intronic
1155885273 18:31200026-31200048 GGGTGGAAAGGCAAAGTCAATGG + Intergenic
1157316937 18:46600054-46600076 GAATGAAAGTGCTAGGTCACAGG - Intronic
1157502809 18:48202956-48202978 GGGTAAGAGGGCAAGGCCAGGGG - Intronic
1159955994 18:74518993-74519015 TCCTGAAAGGTCAAGGTCACGGG - Exonic
1160587229 18:79919481-79919503 GAGTGAGAGGTCAAGGTCAGTGG + Intronic
1160587314 18:79919901-79919923 GAGTGAGAGGTCAAGGTCAGTGG + Intronic
1160587344 18:79920054-79920076 GAGTGAGAGGTCAAGGTCAGTGG + Intronic
1160587557 18:79921122-79921144 GAGTGAGAGGTCAAGGTCAGTGG + Intronic
1160587671 18:79921695-79921717 GAGTGAGAGGTCAAGGTCAGTGG + Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161360889 19:3849120-3849142 GGTTGGAGGGGCAAGGTCTCAGG - Intronic
1162263696 19:9552717-9552739 GGGGGAAAGGGGTAGGTCCCTGG - Intergenic
1162501996 19:11059508-11059530 GGGTGAAAGGTCAGGCACACTGG - Intronic
1162526678 19:11210413-11210435 GGGTGAACAGGCAAGGAGACAGG - Intronic
1162526684 19:11210441-11210463 GGGTGAACAGGCAAGGAGACAGG - Intronic
1162558502 19:11402289-11402311 GGGTCAAGGGTCAAGGTCAGGGG + Intronic
1163218303 19:15896821-15896843 AAGTCAGAGGGCAAGGTCACGGG + Intronic
1165043398 19:33084955-33084977 GGATAAAAGGGCAAAGTCGCTGG - Intronic
1165219847 19:34306543-34306565 GGGCTAAGGGGCAAAGTCACTGG - Intronic
1166046640 19:40234153-40234175 GGGCGCATGGGCAAGGGCACAGG - Intronic
1167153256 19:47722370-47722392 GGGAGGAAGGGCCAAGTCACTGG - Intronic
1168316914 19:55488544-55488566 GGGTGAAAGGGGAAGGAGAGCGG - Intronic
927199134 2:20567739-20567761 GGGTGAAAGGGCAAGGTCACAGG - Intronic
928243900 2:29610687-29610709 CTGTGAAAGGAAAAGGTCACTGG + Intronic
928248865 2:29657097-29657119 GGGTGGCAGGGCAAGGGCACTGG - Intronic
928658744 2:33479569-33479591 GGGTGTAAGGGGTGGGTCACGGG + Intronic
929409395 2:41680073-41680095 GGCTGAAATGGGAAGATCACCGG - Intergenic
932357370 2:71077652-71077674 GGCTGGAAGGGCAAGGGCAGGGG + Intronic
936634080 2:114235425-114235447 GGTGGAAAGGCCAAGGTCCCTGG + Intergenic
937557202 2:123172978-123173000 GAGTGAAACGGCTGGGTCACAGG + Intergenic
938274560 2:130006375-130006397 GGGTGAAAGGGTAAGGGAACTGG - Intergenic
938440807 2:131330897-131330919 GGGTGAAAGGGTAAGGGAACTGG + Intronic
938464691 2:131518154-131518176 GGGTTAAACGGCGGGGTCACGGG - Intergenic
938524843 2:132119559-132119581 CGGAGACAGGGCAAGATCACAGG - Intergenic
939257952 2:139769309-139769331 CAGTGAAAGAGAAAGGTCACTGG + Intergenic
942617533 2:177809569-177809591 GGATGAAAGGGCAAAGTCTTAGG - Intronic
943309450 2:186308542-186308564 TAGGGAAAGAGCAAGGTCACAGG + Intergenic
944074336 2:195711193-195711215 TGGTTAAAGGGAAAGCTCACTGG - Intronic
944418724 2:199505438-199505460 GGGTTAAAGGGCATAGACACTGG + Intergenic
944513046 2:200483479-200483501 GGGTGAATGGGGCAGGTAACTGG + Intergenic
944584993 2:201165630-201165652 GGGTGATTTGGCAGGGTCACAGG + Exonic
945884007 2:215355482-215355504 GTGTCAAAGGGCAAGGCAACGGG - Intergenic
946036451 2:216746244-216746266 GGGTGAAATTCCCAGGTCACTGG - Intergenic
947374196 2:229479262-229479284 GTGTGAAAGGGCTTGGACACAGG - Intronic
948460145 2:238125243-238125265 GGGTGAATGGGCCTGGTCAGTGG - Intronic
1168754252 20:305147-305169 GGGAGAAAGGGCGTGGTCCCTGG + Intergenic
1169553882 20:6729532-6729554 GAGTGAAATTGCCAGGTCACAGG + Intergenic
1169591409 20:7147037-7147059 GGGGGAGAGGACAAGGGCACTGG - Intergenic
1171458310 20:25284075-25284097 GGGTGAAAGGGAAAGATGGCTGG - Intronic
1172064623 20:32210204-32210226 CGGAGAAAGGCCAAGGTCAGTGG - Intronic
1172229108 20:33325045-33325067 GGGTGACAGTGCAGGGTTACTGG - Intergenic
1173021403 20:39270792-39270814 TGGTGAAAGGTCAAAGTCAGAGG - Intergenic
1174204528 20:48828721-48828743 GGTGGAAAGGGCAGGGTCAGGGG - Intergenic
1174536184 20:51253391-51253413 GGATGAAGGGGCCAGGTCATTGG - Intergenic
1174913094 20:54627627-54627649 GGGTGACAGGGTAAGGGTACGGG + Intronic
1175872582 20:62215500-62215522 GGGTGAAAGGGCCAGGCCTGAGG + Exonic
1175939816 20:62532774-62532796 GGCTGAAGGTGCAAGGTCACAGG + Intergenic
1176018543 20:62951293-62951315 GGGTGAAGGGGCCATCTCACAGG - Intergenic
1176794262 21:13359531-13359553 GGGTTAAGGGTCAGGGTCACGGG - Intergenic
1178075929 21:29012718-29012740 GGGGGATTGGGCATGGTCACAGG - Intronic
1178132749 21:29591713-29591735 GGGTGAAGGGGCAGGGTGAATGG + Intronic
1178713821 21:34945369-34945391 GGCTGCAAGGCCAAGGTCAAAGG - Intronic
1179175347 21:39004222-39004244 GGGTTAAAGGTCAGGGTGACTGG + Intergenic
1180459950 22:15553640-15553662 GGATGAAAGGGCAAGGGAACTGG + Intergenic
1180978563 22:19866947-19866969 GAGTGAAATGGCTAGGTCATAGG - Intergenic
1182527591 22:30931042-30931064 GGGTGAAAGGGCTGTGTCAGAGG - Intronic
1182692117 22:32171459-32171481 GGGACAAAGGGCCAGGTCTCCGG - Intergenic
1182935651 22:34219336-34219358 GTGTTAAAGGGCAAGTTCTCTGG + Intergenic
1183186988 22:36297808-36297830 GGATGGAACGGCCAGGTCACCGG + Intronic
949405932 3:3714587-3714609 GGGTGACATGCTAAGGTCACAGG - Intronic
949638805 3:6012776-6012798 GGGAGAGAGGGCAGGGTGACAGG - Intergenic
949918648 3:8984702-8984724 GGGTGGAAGGGCAGGGTCTCTGG + Exonic
950577750 3:13842934-13842956 GGCTGAAAGGACAAGGGCAGAGG + Intronic
950661820 3:14471571-14471593 GGGTGCAGGGGCAAGGTCCCAGG - Intronic
950996004 3:17496939-17496961 GGGTGACAGGGGAATGACACAGG - Intronic
951160094 3:19408291-19408313 GGGTGGAAGGGGAAGGTAAAGGG + Intronic
953802020 3:46031612-46031634 GGCAGAAAGGGCCAGGTCCCTGG + Intergenic
953881823 3:46694761-46694783 GGGCAAAAGGGTGAGGTCACTGG - Intergenic
954577833 3:51686556-51686578 CGGTGATAAGGCAAGGGCACAGG + Intronic
956428790 3:69164072-69164094 GGCTGAAATGGGAAGATCACCGG - Intergenic
957326337 3:78699837-78699859 GGGTGAAAGGGGAAGATTCCAGG - Intronic
957837718 3:85619447-85619469 GAGTGAAAGGGCAAGAATACTGG - Intronic
959021868 3:101196138-101196160 GGGTGAAAGGGTAGGGATACAGG + Intergenic
959254460 3:103991750-103991772 GGGTGAAACGGGGAGGTCATGGG + Intergenic
961019769 3:123495777-123495799 GGGAGAAAGGGAAAGGTTACTGG + Intronic
961785451 3:129344313-129344335 GGGTGCAAGGGTAAGGTGCCAGG - Intergenic
961824485 3:129591983-129592005 GGGTGAAGGAGCAAGGGCAAGGG - Intronic
962009917 3:131382412-131382434 TGGGGAGAGGGCAAGGTCAGAGG - Exonic
963608238 3:147432441-147432463 GAGTGAAAGGGAGACGTCACAGG + Intronic
964160632 3:153641032-153641054 GGATGAAAGTCCCAGGTCACTGG - Intergenic
964703632 3:159595398-159595420 GGGTGAAATGACAAGATCAAGGG + Intronic
966211164 3:177454791-177454813 GGGTGAAAAGGCCTGGCCACGGG + Intergenic
966570021 3:181430778-181430800 GGAGGAAAGGGCAAGGGCAGAGG + Intergenic
967111559 3:186298238-186298260 GGGCAAAAGGGCAAAGTCAGTGG + Intronic
967390357 3:188948544-188948566 GGGTGAAAGGAGAAGGTTCCAGG + Intronic
968064868 3:195753022-195753044 GGGTGAGAGGGCGGGGTCTCTGG + Intronic
969008645 4:4042399-4042421 TGGAGACAGGGCAAGATCACAGG + Intergenic
969273300 4:6117483-6117505 TGGAGACAGGGCAAGATCACAGG + Intronic
969647720 4:8442396-8442418 GGCTGAAGTGTCAAGGTCACGGG - Intronic
969745040 4:9063971-9063993 TGGAGACAGGGCAAGATCACAGG - Intergenic
973622205 4:52738106-52738128 GGGGGAAAGGTCAAATTCACAGG + Intronic
974412560 4:61560915-61560937 AGGTGAAAGGTCATGGTAACGGG + Intronic
974718180 4:65698862-65698884 GAGTGAAAGGAAAAGGTCAGGGG + Intergenic
977557679 4:98501537-98501559 GGAAGAAAGGGCTAGGTCAAAGG + Intronic
977924567 4:102685571-102685593 AGTTGAGAGGGCAAGGTCTCTGG - Intronic
978319618 4:107479216-107479238 GGGTGGAAGGGCAGGTTCTCAGG - Intergenic
980744948 4:137001071-137001093 GGCAGAAAGGGGAAGGTCCCTGG + Intergenic
981963354 4:150569511-150569533 GGATGAAATGGCAAGCCCACAGG - Intronic
982329257 4:154163178-154163200 GGGTGAAAGGGGAAAGTCACAGG + Intergenic
983099616 4:163608819-163608841 GTCTGAGAGGGCAAGTTCACAGG + Intronic
983769605 4:171533079-171533101 GAGAGAAAGTGCAAGCTCACAGG - Intergenic
985577674 5:681318-681340 GGGTCAAAGGACAAGCTCCCAGG + Intronic
986273569 5:6254303-6254325 GGGTGAAAGGACAAGGACCCTGG - Intergenic
988081630 5:26422659-26422681 GAATGAGAGAGCAAGGTCACTGG + Intergenic
992965620 5:81997047-81997069 GGGTGAGGGGGTAGGGTCACTGG - Intronic
994503976 5:100616726-100616748 GGGTCAAAGAGCAAGGCAACTGG + Intergenic
996020172 5:118582437-118582459 AGGTGAAAGCAGAAGGTCACTGG + Intergenic
996416659 5:123217897-123217919 AGGTGAACGGGAAAGGACACAGG + Intergenic
996481525 5:123980888-123980910 AGGAGAGAGGGCTAGGTCACTGG - Intergenic
998806421 5:145921461-145921483 GGGAGAAAGGGAAAAGTCAGTGG - Intergenic
999207907 5:149863290-149863312 TGGTGCAAGGGCCAGGCCACAGG + Intronic
999818505 5:155200973-155200995 GGGTGAGAGTCCCAGGTCACTGG - Intergenic
1000537272 5:162494101-162494123 GGGGGACAGGGCAGGGTCATGGG + Intergenic
1001887574 5:175309284-175309306 CAGTGAAAGGGCAAGGTATCTGG - Intergenic
1002000196 5:176192900-176192922 GGGAGAAAGGGCAGGACCACAGG + Intergenic
1002644938 5:180648541-180648563 GGGTGTAAGGGCGGGGTCAGGGG - Intronic
1003029438 6:2589266-2589288 GGGTGAGAGTCCAGGGTCACTGG + Intergenic
1003624435 6:7728489-7728511 GGGAGAAAGGGCGATGTGACTGG - Intronic
1004004107 6:11623242-11623264 GTGTGAAAGGGAAGAGTCACTGG + Intergenic
1005080564 6:21952763-21952785 GGGGGAAATGATAAGGTCACAGG + Intergenic
1008587877 6:52965494-52965516 GGGTGAAAGAACATGGGCACAGG + Intergenic
1009181046 6:60517836-60517858 GGGTGAGAGTCCCAGGTCACTGG - Intergenic
1009287531 6:61839720-61839742 GGGTGAAAGATCAAGAACACAGG + Intronic
1012122639 6:95386701-95386723 TGGAGACAGGGCAAGATCACAGG + Intergenic
1012446002 6:99307620-99307642 GGCTGTGAGGGCAAGGTCAGGGG + Intronic
1012448159 6:99327845-99327867 TGGAGAAAGGGCAAATTCACAGG - Intronic
1012838774 6:104303173-104303195 GGGTGGAAGGGAAAGGTAAGGGG - Intergenic
1015939111 6:138431310-138431332 GGGGGCAATGGCAAGGACACAGG + Exonic
1019320978 7:415149-415171 GGGTGACAGGGCCAGCTCACGGG + Intergenic
1019320995 7:415206-415228 GGGTGACAGGGCCAACTCACGGG + Intergenic
1019685801 7:2381421-2381443 GGATGAAACTGCAGGGTCACAGG - Intergenic
1019701469 7:2476577-2476599 GGGTGACTTGGCAAGGTCTCTGG + Intronic
1020649229 7:10854946-10854968 GGGTGGAAGGGACAGGTCCCTGG + Intergenic
1021105062 7:16628685-16628707 GGGTGGTAGGGGAAGGACACAGG + Intronic
1023579326 7:41664456-41664478 TGGCGAAGGGGCAAGGTCAAGGG + Intergenic
1024545470 7:50513770-50513792 GGGTGAGAGTCCTAGGTCACTGG - Intronic
1024613162 7:51084313-51084335 GGGTTAAAGGGCATGGTGAGTGG + Intronic
1024707090 7:51972573-51972595 GGCTGGAAGGGGAAGGTCAGTGG + Intergenic
1026661406 7:72305901-72305923 GGGAGAGAGGGCAAGCTCTCTGG + Intronic
1032284680 7:130531346-130531368 GGGTGCAAGGTCAAGGTAAGGGG + Intronic
1033160736 7:138994125-138994147 GGGTGAAGGGGGAGGGACACGGG - Intergenic
1035080176 7:156209230-156209252 TGGAGAAAGGCCAAGGTCAGAGG + Intergenic
1036909467 8:12742824-12742846 GGCTGAAGTGGGAAGGTCACTGG - Intronic
1038237079 8:25769496-25769518 GGGTGAGAGTCCCAGGTCACTGG - Intergenic
1040576217 8:48653852-48653874 GGGTGCAAGGGAAATGTGACTGG - Intergenic
1042782611 8:72508777-72508799 GGGAGAAAGGGCAATCTCTCTGG + Intergenic
1043955329 8:86352606-86352628 GGGAGAGAGGGCAAGGTGAGAGG - Intronic
1047180389 8:122582241-122582263 AGGAGAAAGTACAAGGTCACTGG - Intergenic
1047233586 8:123018864-123018886 TGGTGAATGGGCAGAGTCACAGG - Intronic
1047514381 8:125541032-125541054 GGGGGCAAGGGCAAGTTCATTGG + Intergenic
1048876830 8:138843236-138843258 CGGTGACATGGCAAGGTCCCTGG + Intronic
1049032778 8:140049648-140049670 AGCTGAAAGGGGAAGGTCACAGG + Intronic
1049850610 8:144828141-144828163 GGGTGGAAGCCCCAGGTCACCGG - Intronic
1050586071 9:7112622-7112644 GGGGGCCAGGGCAAGCTCACTGG - Intergenic
1051151386 9:14083278-14083300 GGGTCAAAGGGCAAAATCAGTGG + Intronic
1055669435 9:78587936-78587958 GAATGAAATCGCAAGGTCACAGG - Intergenic
1057309223 9:93931340-93931362 GGGGGCAAGGGCATGGACACAGG + Intergenic
1059217201 9:112575135-112575157 GGGAGAAAGGGCTACCTCACAGG - Exonic
1059458336 9:114413601-114413623 GGGCCAAAGGGAAAGGTCAGAGG + Intronic
1060807880 9:126588864-126588886 GGAGGAAACGGCAAGGTCACTGG - Intergenic
1189259245 X:39666417-39666439 GGGTGAAAGGGGAGGCTCAGTGG + Intergenic
1189291849 X:39891836-39891858 GGGTCAAAGGGCAATGATACAGG - Intergenic
1190133672 X:47774277-47774299 GGGGGAAAGGGTATGGACACAGG - Intergenic
1197044449 X:121978567-121978589 GGGAGAAAAGGCAGGGTAACAGG - Intergenic
1197422688 X:126258137-126258159 GTGTGAAGGGGCAGGGTCACTGG + Intergenic
1198314839 X:135454969-135454991 GGGGGAAAAGGCAAAGTCACAGG - Intergenic
1198526777 X:137509305-137509327 GGGTGAGAGTCCCAGGTCACTGG + Intergenic
1200248435 X:154539146-154539168 GGGTGGAACGGCCAGGTCACAGG - Intronic
1202370423 Y:24192234-24192256 GGCTGAAAGGGAAACATCACTGG + Intergenic
1202500361 Y:25477883-25477905 GGCTGAAAGGGAAACATCACTGG - Intergenic