ID: 927199893

View in Genome Browser
Species Human (GRCh38)
Location 2:20571655-20571677
Sequence ATGTGGGCCCCAGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927199893_927199904 13 Left 927199893 2:20571655-20571677 CCTGGACCTGCTGGGGCCCACAT 0: 1
1: 1
2: 2
3: 28
4: 282
Right 927199904 2:20571691-20571713 TACTTCTGTGCCCCTGCCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 199
927199893_927199897 -10 Left 927199893 2:20571655-20571677 CCTGGACCTGCTGGGGCCCACAT 0: 1
1: 1
2: 2
3: 28
4: 282
Right 927199897 2:20571668-20571690 GGGCCCACATCCTGGCCCATGGG 0: 1
1: 0
2: 0
3: 24
4: 188
927199893_927199903 12 Left 927199893 2:20571655-20571677 CCTGGACCTGCTGGGGCCCACAT 0: 1
1: 1
2: 2
3: 28
4: 282
Right 927199903 2:20571690-20571712 GTACTTCTGTGCCCCTGCCTTGG 0: 1
1: 0
2: 1
3: 30
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927199893 Original CRISPR ATGTGGGCCCCAGCAGGTCC AGG (reversed) Intronic
900473561 1:2865984-2866006 ATTGGGGCCCCTGCAGGTCAGGG - Intergenic
900525113 1:3124749-3124771 AGGTGGGCCCCAGCAGGATGGGG + Intronic
900589775 1:3454493-3454515 ACGTGGGCTCCAGCCGGCCCAGG + Exonic
902464493 1:16607685-16607707 ATGTGGTCACCCACAGGTCCTGG - Intronic
902727723 1:18348340-18348362 ATGTGAGACACAGAAGGTCCAGG - Intronic
903020191 1:20388118-20388140 ATGCGGTCACCAGCAGCTCCAGG + Intergenic
903156318 1:21446021-21446043 ATGTGGTCGCCCACAGGTCCTGG + Intronic
904317294 1:29673727-29673749 AGGTGGGCCCCAGGATGCCCAGG - Intergenic
904355236 1:29934398-29934420 ATCTGGGGCCCAGCCGGTCCCGG + Intergenic
906061425 1:42951733-42951755 GTGTGGGGCCTACCAGGTCCTGG - Intronic
906189172 1:43884911-43884933 GTGTGGGCACCAGCAGATCTAGG - Intronic
906676794 1:47699032-47699054 TTCTGGGCCCTGGCAGGTCCTGG - Intergenic
907011772 1:50969450-50969472 ATGCCGGCCCCGCCAGGTCCCGG - Exonic
907606669 1:55825103-55825125 ATGTGAGCCACTGAAGGTCCAGG - Intergenic
912209808 1:107545419-107545441 CTGTGGGGCCCAGCACATCCTGG + Intergenic
912270204 1:108200523-108200545 AAGAGGCCCCCAGCAGGTCCAGG + Intronic
912520808 1:110243473-110243495 CTCCTGGCCCCAGCAGGTCCGGG - Intronic
915018867 1:152761081-152761103 ATTTGGGCCCCAGCATGGGCTGG - Exonic
916072105 1:161176462-161176484 ATGGGGGCTCCAGGGGGTCCCGG + Exonic
918142600 1:181732080-181732102 ATGGCTGCCCCAGCAGGCCCTGG + Intronic
922195477 1:223355957-223355979 GTGCAGGCCCCAGCAGGTCAGGG - Intronic
922447488 1:225709737-225709759 ATGTGCGCCCCATGAGGTCATGG + Intergenic
922542117 1:226427464-226427486 ATGTGGGCCCCTGTGGGCCCAGG - Intergenic
924451573 1:244183505-244183527 ATGTGGGCCGATGCAAGTCCAGG + Intergenic
1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG + Intergenic
1064589796 10:16877516-16877538 TTGTGGGTCCCAGAGGGTCCGGG - Intronic
1067146947 10:43701132-43701154 ATGTGTGCCCCAGTGGGTCCCGG + Intergenic
1067291948 10:44950131-44950153 AGCTGGGCCCCAGCAGAGCCTGG + Intergenic
1069121926 10:64577654-64577676 ATGGTGGCCCGAGCAGCTCCAGG - Intergenic
1069635505 10:69922610-69922632 GTGTGGGCCCCAGGATGTCTGGG - Intronic
1071334273 10:84588735-84588757 AGGTGGTCCTCATCAGGTCCGGG + Intergenic
1076785786 10:132749258-132749280 CTGTGGGCGGCAGCAGCTCCGGG + Intronic
1077023565 11:430248-430270 AGGTGGGCCGCAGCAGGGGCCGG - Exonic
1077602359 11:3582332-3582354 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1077713215 11:4556323-4556345 ATGAGTGCTACAGCAGGTCCAGG + Intergenic
1078627250 11:12968815-12968837 ACATGGGCTCCAGCAAGTCCTGG + Intergenic
1078627539 11:12971309-12971331 ATTTGAGCCCCAGGAGGTCGAGG - Intergenic
1081330477 11:41794095-41794117 ATTTGGGCCCAATAAGGTCCAGG - Intergenic
1082990854 11:59206171-59206193 ATGAGGGACCCAGCAGCTCTGGG - Exonic
1083389534 11:62337734-62337756 CTGAGACCCCCAGCAGGTCCGGG + Intronic
1084046064 11:66568357-66568379 GGGTGGGCGCCAGCAGCTCCGGG + Exonic
1084517128 11:69643126-69643148 AAGTGGCCCCCAGCAGCTGCAGG - Exonic
1084760760 11:71269172-71269194 ATCTGGGACTCAGCATGTCCAGG - Intergenic
1084785177 11:71437973-71437995 ATGGGGGCCCCAGGAGGGCCGGG - Intronic
1084814497 11:71638331-71638353 AAGTGAGCACCAGCAGCTCCTGG - Intergenic
1085042599 11:73335267-73335289 ATGTGGGACCCAGAAGATCTGGG + Intronic
1085415022 11:76313975-76313997 CTCTGGCCCCCAGCAAGTCCTGG + Intergenic
1090401976 11:126454741-126454763 ATGTGGGTCCAGCCAGGTCCAGG - Intronic
1090940196 11:131380627-131380649 CTGTGGGCTCCAGAAGGGCCAGG + Intronic
1092428502 12:8391684-8391706 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1092429587 12:8397836-8397858 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1094433795 12:30398991-30399013 ATGTGGGCCCCAGGGAGGCCTGG - Intergenic
1094840042 12:34339028-34339050 CTGTGGGGCCCAGCAGCTCCGGG - Intergenic
1094841643 12:34344877-34344899 ACGTGGGGCCCAGCAGCTCCAGG + Intergenic
1095943548 12:47741010-47741032 CAGTGGGCCCCAGCTGGTCAGGG + Exonic
1096004912 12:48161682-48161704 ATGTGGCCCACATCTGGTCCAGG - Intronic
1096193386 12:49634077-49634099 AGGAGGGCCCCAGCAGGTGAGGG + Exonic
1096595163 12:52690549-52690571 ATGTGGTCCCCAGCAGGGCAGGG + Exonic
1096670872 12:53197643-53197665 AGGGGAGCCCCAGCAGCTCCAGG - Exonic
1097051947 12:56229040-56229062 CTGAGTGCCCCACCAGGTCCCGG + Exonic
1099682418 12:85844869-85844891 CTTTGGGGCCCTGCAGGTCCTGG + Intergenic
1099890240 12:88580767-88580789 AGGTGAGCCCCAGCGGATCCGGG - Intronic
1101309512 12:103563713-103563735 ATGTGCTCTCCAGCAGGTCCTGG - Intergenic
1103928843 12:124438376-124438398 CTGTGGGCGGCAGCAGGTCTCGG - Intronic
1104461265 12:128958128-128958150 ATGTGTGCCCCAGAAGTTACTGG - Intronic
1104667212 12:130656132-130656154 GTGTGGGCCCCGGGAGGGCCAGG + Intronic
1107043511 13:35973022-35973044 CTGTGGGCCCCAGAATGTACTGG - Intronic
1108526465 13:51289737-51289759 ACCTGAGCCCCAGGAGGTCCAGG + Intergenic
1108736017 13:53283953-53283975 ATGTTTACCCCAGTAGGTCCTGG + Intergenic
1112564753 13:100543894-100543916 AAATTGGCCCCAGCAGATCCTGG + Intronic
1113877130 13:113601538-113601560 TTGGGGGCCCCTGCAGGGCCAGG + Intronic
1118642130 14:67802652-67802674 AAGTGTGCCCCAGTGGGTCCAGG + Intronic
1119219318 14:72893435-72893457 ACCTGGGCCCCAGCACGCCCGGG + Intronic
1119738461 14:76999000-76999022 AGCTGGGCCCTAGCAGGCCCTGG + Intergenic
1120174393 14:81277749-81277771 GTGTGGGCCACAGCAGGTTTGGG + Exonic
1120881208 14:89416741-89416763 ACGAGGGACCCCGCAGGTCCTGG - Intronic
1121492259 14:94369052-94369074 GTGAGGGCCCCAGCAGGTAGAGG + Intergenic
1121753329 14:96378208-96378230 AGGTGGGTGCCATCAGGTCCGGG - Intronic
1122111598 14:99507196-99507218 ATGTTGGACGCAGCAGGTCCTGG + Exonic
1122148583 14:99708770-99708792 ATGTGGGCGCCAGCAGTAGCGGG - Intronic
1122637667 14:103138052-103138074 GTGTGGGCTTCAGCAGGGCCTGG + Intergenic
1122642180 14:103166332-103166354 ATTTGGCCCCCATGAGGTCCAGG + Intergenic
1122878478 14:104679448-104679470 CTGTGGGCCCAAGCAAGCCCCGG + Intergenic
1122901605 14:104784438-104784460 GTGTGGGGCCCAGGAGGTGCAGG - Intronic
1122923385 14:104889146-104889168 GCCTGGGCCGCAGCAGGTCCTGG + Intronic
1125504648 15:40260098-40260120 GTTTAGGCCCCAGCAGGTCGTGG + Intronic
1125518347 15:40335259-40335281 GTCTGGGGCCCAGCAGGGCCTGG - Exonic
1130738074 15:86571149-86571171 TTGGGGCCCCCAGCAGTTCCTGG - Intronic
1131070316 15:89461725-89461747 ATGAGAGCCCCAGCAAGTACAGG - Intergenic
1132154701 15:99487172-99487194 ATGGGGACCCCAGCAGGTTAGGG - Intergenic
1132335765 15:101047472-101047494 AAGTGGGGCCCAGCTGGGCCTGG + Intronic
1133457631 16:5956750-5956772 ATCTGAGCCCCAGGAGGTCTAGG - Intergenic
1135648164 16:24181682-24181704 ACCTGAGCCCCAGGAGGTCCAGG + Intronic
1137599427 16:49746166-49746188 ATGTTGGCCCCTGCTGTTCCAGG + Intronic
1138348394 16:56333737-56333759 AGCTGGCCCCCAGCAGGTCCTGG + Intronic
1138679956 16:58677262-58677284 ACTTGGGCCCCAGCAGGTGCTGG - Intronic
1139922777 16:70470385-70470407 ATCTGGGCCCCAGGAGCCCCGGG - Exonic
1141994484 16:87627937-87627959 CTGTGGGCCCCACCACCTCCTGG + Intronic
1142062034 16:88036553-88036575 ATTTGGACACCAGCAGTTCCCGG + Intronic
1142352563 16:89586849-89586871 TGGTGGGCCCCAGCACGTCTGGG + Intronic
1142583938 17:959113-959135 TGCTGGGCCCCAGCAGCTCCTGG - Intronic
1142604212 17:1072736-1072758 GTGTGTGCTTCAGCAGGTCCTGG + Exonic
1143150718 17:4806712-4806734 ATGTGGCTCGCAGCGGGTCCGGG + Intergenic
1143400656 17:6640218-6640240 GCGTGGGGCCCAGCAGGTCGGGG - Intronic
1143632714 17:8148054-8148076 CTGGGGCCCCCAGGAGGTCCTGG + Exonic
1143733921 17:8897147-8897169 CTGTGGGCCTCAGCAGGGCCTGG + Intronic
1144831180 17:18132009-18132031 AGGTGGGCTCCATCAGGTCAGGG + Intronic
1144853763 17:18257246-18257268 TTCTGGGCCCCAGGAGGGCCAGG + Intronic
1145243430 17:21252783-21252805 AAGTGGGCCTGAGCAGGTGCGGG + Intronic
1148890485 17:50803474-50803496 CTGTGGGCTTCAGCAGCTCCAGG + Intergenic
1149238057 17:54616428-54616450 TTTTGGGGCCCAGCAGTTCCTGG + Intergenic
1150143359 17:62748659-62748681 ATTTGAGCCCCAGGAGGTCGAGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151568958 17:74916489-74916511 ATGGGGGCCCCAGGAGATGCTGG + Exonic
1152195948 17:78918445-78918467 AGGTGGGCCCTGGGAGGTCCTGG + Intronic
1152559676 17:81071763-81071785 ATGTGAGCCACAGCAGCTCGTGG - Intronic
1152699842 17:81813395-81813417 ATGAGGCCCACAGCAGGTCCCGG + Intronic
1152722757 17:81930946-81930968 ATGTGGGCCTCAGCAGGTCAAGG - Intergenic
1152755787 17:82086480-82086502 ATCTGGGCCCCATCCAGTCCGGG + Exonic
1153085203 18:1278329-1278351 TTCCTGGCCCCAGCAGGTCCTGG + Intergenic
1155167865 18:23245901-23245923 TTGTGGCCCGCAGCAGGCCCAGG - Intronic
1156129243 18:33949483-33949505 ATGTTGCCACCAGCAGTTCCAGG - Intronic
1157578978 18:48762484-48762506 ATGGTGGCCACATCAGGTCCTGG + Intronic
1158478643 18:57802563-57802585 AAGAGCGCCCCAGCAGGACCCGG + Intronic
1159121423 18:64175895-64175917 CTGTGTGCCCCAGCATGCCCTGG + Intergenic
1159966788 18:74602863-74602885 ATGTGTTTCCCAGCAGGACCAGG - Intronic
1161296727 19:3523902-3523924 TGGTGGGCTCCCGCAGGTCCCGG - Intronic
1161680984 19:5679690-5679712 CGCTGGGCCCCAGCAGCTCCTGG + Exonic
1162792711 19:13071290-13071312 ATTTGAGCCCCAGCCAGTCCGGG - Intronic
1162792789 19:13071774-13071796 ATGAGGGCCCCACCATGTCTGGG - Intronic
1163484069 19:17576259-17576281 CTCTGGGCCCCAGCAGCACCTGG - Intronic
1163602002 19:18254966-18254988 CTGTGGCCTCCAGCAGGTTCAGG + Intronic
1163687381 19:18719434-18719456 AGGTGGGCCCCGGCAGGCCCAGG + Intronic
1164720718 19:30429938-30429960 ATGTGGGCCCCAGGAGGTCCTGG + Intronic
1164753573 19:30673267-30673289 ATGTGTGCCCCTGAAGGGCCAGG - Intronic
1165983250 19:39744496-39744518 TTGTTGGCCTCAGTAGGTCCTGG - Intergenic
1166111009 19:40622878-40622900 AAGTGGGCACGAGCAGGTCAGGG + Intronic
1166125870 19:40715075-40715097 AGGAGGGCCCCAGCAGGTTGCGG - Intronic
1166385331 19:42377386-42377408 ATGTGGGGCCCACAAGGCCCTGG - Exonic
925250653 2:2434415-2434437 CTGAGGGCCACAGCTGGTCCTGG - Intergenic
925862323 2:8191708-8191730 ATGTGGGCCACAGAAGGGCCAGG - Intergenic
927199893 2:20571655-20571677 ATGTGGGCCCCAGCAGGTCCAGG - Intronic
928433756 2:31240500-31240522 ATGAGGCCACCAGCAAGTCCAGG - Intronic
930030810 2:47057002-47057024 ATGTGGGCACCACTGGGTCCTGG + Intronic
931196299 2:60054976-60054998 ACGTTGGCCTCAGCAGGTGCTGG - Intergenic
931899250 2:66769677-66769699 ATGAGGGCCCCAGCAGTAACAGG - Intergenic
934027412 2:88012757-88012779 ATGGAGGCCCCTGCAAGTCCAGG + Intergenic
935424444 2:102905230-102905252 ATATGGACTACAGCAGGTCCTGG - Intergenic
936126055 2:109789889-109789911 ACGGGGGGCCCAGCAGGGCCTGG + Intergenic
936218638 2:110581579-110581601 ACGGGGGGCCCAGCAGGGCCTGG - Intergenic
936518589 2:113197996-113198018 TTGTGGGCCCCAGGGGGTCCTGG + Intronic
936593247 2:113823549-113823571 AGGTGGGGCCCAGGAGGTCAAGG + Intergenic
937376685 2:121341218-121341240 AGGTGGGCCGCAGCAGCTCATGG + Intronic
937536620 2:122896643-122896665 GTGTGGGCCTCTGCAGGTCTAGG + Intergenic
937639356 2:124193930-124193952 AAGTGAGACCCAGCAGGACCGGG + Intronic
937954072 2:127409250-127409272 CTTTGAGCCCCAGGAGGTCCAGG + Intergenic
937969282 2:127536838-127536860 GTAGGGCCCCCAGCAGGTCCAGG - Intronic
938135539 2:128753568-128753590 ATCTGGGCTCCAGCAGGTTGAGG - Intergenic
938416296 2:131105828-131105850 CGGCGGGCCGCAGCAGGTCCCGG - Intronic
940992720 2:160114470-160114492 ATGTGGGCCTGGGAAGGTCCAGG + Intronic
941462664 2:165789772-165789794 AAGTGTACCCCAGCAGGGCCTGG + Intronic
942315472 2:174693130-174693152 CTTTGGGGCTCAGCAGGTCCTGG + Intergenic
942791573 2:179766965-179766987 GCCTGGGCCCCAGCAGTTCCAGG + Intronic
948508289 2:238446043-238446065 CTGAAGGCCCCAGCAGGTGCGGG - Intronic
948674873 2:239591335-239591357 GTGTGGGCTCCAGGAGGGCCTGG + Intergenic
948691813 2:239711054-239711076 GTGTGAGCCCCAGGAGCTCCAGG - Intergenic
948845327 2:240680304-240680326 CTGTGGGCCCCAGCAGCCCTAGG + Intronic
948848534 2:240694575-240694597 CTGTGGGCCCCAGCAGCCCTAGG - Intronic
1168750332 20:277439-277461 ACCTGGGCCCCAGGAGGCCCAGG + Intronic
1168809674 20:696715-696737 ATGTGGACCCCAACAGCTTCAGG - Intergenic
1168851790 20:981932-981954 ATGTGGTCCAGGGCAGGTCCAGG - Intronic
1168897518 20:1333978-1334000 ATGTAGGTCCCAGCAGGGCTCGG - Intronic
1169140150 20:3223227-3223249 GAGTGGGGCCCAGCAGCTCCTGG - Intronic
1169226694 20:3861397-3861419 CTGTGGGCCGCAGCAGGTGTGGG - Exonic
1169297570 20:4413209-4413231 AAGTGAGGCCCAGCAGCTCCTGG - Intergenic
1169345375 20:4824148-4824170 CTGGGGGCGCCAGGAGGTCCAGG - Intergenic
1171362579 20:24598558-24598580 CTGTGGGCCCCACCCAGTCCTGG - Intronic
1172847793 20:37940264-37940286 GGGTGGGCTCCAGCAGGGCCTGG + Intronic
1175886912 20:62297308-62297330 ATGTCAGACCCAGCAGGGCCCGG + Intergenic
1176060969 20:63172867-63172889 TTGTGGGGCCCAGCTGGCCCAGG - Intergenic
1179812609 21:43882180-43882202 ATGTGGGGCCCGGCAGGGCGGGG - Intronic
1180220378 21:46354749-46354771 CTGTGGCCTCCAGCAGGCCCAGG - Intronic
1180875061 22:19171358-19171380 GCGTGGGCCCCCGCTGGTCCCGG + Intergenic
1181014341 22:20060697-20060719 CTGGGGGCCCCAGCAGAGCCAGG + Intronic
1181558129 22:23683849-23683871 GTGTGAGCTTCAGCAGGTCCTGG + Intergenic
1182355704 22:29721405-29721427 ATGGGGGCTCCAGGAGGTCTGGG - Intronic
1182711735 22:32327529-32327551 ATCTGGTCCCCAGCAGGCCTCGG - Intergenic
1184004315 22:41697368-41697390 TTGTGGGCCACACCAGCTCCTGG - Exonic
1184399261 22:44264317-44264339 ATCTGGTCCCCAGCAGGCCTCGG - Intronic
1185217468 22:49609690-49609712 GTGTGGCCTCCAGCAGCTCCAGG - Intronic
950407330 3:12812977-12812999 AGGTGAGCCCCTGCAGGGCCAGG - Exonic
950547672 3:13648260-13648282 AGAGCGGCCCCAGCAGGTCCCGG + Intergenic
954138199 3:48591967-48591989 ATGTGGGGCCCAGGATGACCGGG + Exonic
954297447 3:49682099-49682121 GGCTGGGCCCCAGCAGTTCCTGG - Intronic
954369204 3:50161411-50161433 ATGTGGGCGCCGGCAAGGCCAGG - Intronic
954398086 3:50303510-50303532 ATGGGGGCCTAAGCAGGGCCTGG + Exonic
955066163 3:55535368-55535390 GTGTGAGTGCCAGCAGGTCCAGG + Intronic
957073207 3:75581399-75581421 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
960091305 3:113641623-113641645 ATGTGGCCCCCAGAATCTCCGGG - Intergenic
961056697 3:123794622-123794644 ATCTAGTCCCCAGCAGGCCCTGG - Intronic
961862203 3:129926049-129926071 ATGTGGGCCCCTGCAGGAGCTGG - Intergenic
961873513 3:130004204-130004226 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
962343177 3:134602039-134602061 ATGAGGGTCCCAGCTGGCCCTGG + Intronic
964882814 3:161443096-161443118 GTGTGGCCTCCTGCAGGTCCTGG + Intergenic
966914614 3:184577899-184577921 CTCTGGGGCCCAGCAGCTCCAGG + Exonic
968656482 4:1780452-1780474 AAGTGTGCACCAGCAGGTCTGGG + Intergenic
968944030 4:3654291-3654313 ATGAAGGTTCCAGCAGGTCCCGG + Intergenic
969306671 4:6329789-6329811 ATCTGGACCCCAGGTGGTCCTGG - Intronic
969737158 4:8999622-8999644 AAGTGAGCACCAGCAGCTCCTGG - Intergenic
969796351 4:9531210-9531232 AAGTGAGCACCAGCAGCTCCTGG - Intergenic
975355909 4:73403622-73403644 ATGTGGGCCACAGCAGGAATGGG + Intronic
977682019 4:99807339-99807361 ATGTGGCCCCCTTCAGGGCCAGG + Intergenic
982224848 4:153155920-153155942 AAGTGAACCCCAGCAGGTCCTGG - Intronic
985686740 5:1285348-1285370 ATGGGAAGCCCAGCAGGTCCAGG + Intronic
985879536 5:2628066-2628088 GTGTGGGCTCCAGCAGGAACGGG + Intergenic
986685319 5:10271129-10271151 GTGGGGGCCCCAGCAAGGCCTGG - Intergenic
986787210 5:11125396-11125418 ATGTGCACCGCAGCAGGTACAGG - Intronic
987076310 5:14385208-14385230 CTGTCTGCCCCAGCAGTTCCAGG + Intronic
989212027 5:38866055-38866077 ATGTGGGCACCAGCAGGCTGGGG + Intronic
989400054 5:40999234-40999256 ATGTGGGGGCCAGCAGCCCCTGG - Intronic
992744693 5:79807565-79807587 ATGTGGGTGCCTGCAGGGCCTGG - Intergenic
994176712 5:96719200-96719222 CTGAGCTCCCCAGCAGGTCCTGG - Intronic
995827033 5:116312042-116312064 TGGTGGGCCCCTGCAGGCCCAGG - Intronic
995860439 5:116635216-116635238 ATCAGGGTGCCAGCAGGTCCGGG + Intergenic
997011222 5:129880778-129880800 ATGAGTCCCCCAGCAGCTCCAGG + Intergenic
997637854 5:135427829-135427851 GAGTGGGCTCCAGCAGGCCCGGG - Intergenic
998085528 5:139319183-139319205 ATGTGAGGCCCAGGAGTTCCAGG + Intronic
1001470528 5:172008892-172008914 ATGTGGGCCCCGGCTGAGCCCGG - Intergenic
1001712278 5:173788619-173788641 ATGGAGGCCCCAGCTGTTCCAGG + Intergenic
1002195206 5:177497459-177497481 TTGTGGTCCTCAGCAGGCCCCGG + Intronic
1005122154 6:22401741-22401763 ATGTGGTCCCCAGAGGGACCTGG + Intergenic
1005286588 6:24334333-24334355 ATGAGGGCCACCGCAAGTCCTGG - Intronic
1006592788 6:35170428-35170450 CTGGGGCCCCCAGCAGGCCCTGG - Intergenic
1007622340 6:43222763-43222785 ATGGGAGCCCCTGCAGGTGCTGG + Exonic
1009232376 6:61079250-61079272 AAGTGGAACCCAGCAGCTCCAGG - Intergenic
1010341223 6:74755242-74755264 ATTTGGGGCCCTGCAGTTCCTGG + Intergenic
1011736251 6:90313480-90313502 AGGTGGTCACCAGCAGCTCCAGG + Intergenic
1014561965 6:122901621-122901643 AGGTGGGCCACAGGAGGGCCTGG + Intergenic
1018269994 6:162066680-162066702 ATCAAGGCCCCAGCAGGTCAAGG - Intronic
1018391043 6:163342313-163342335 ATGAGGTCCCCAGCAGGGGCTGG - Intergenic
1018419607 6:163630557-163630579 ATTAGGGCCGCAGCCGGTCCAGG + Intergenic
1018638547 6:165886183-165886205 ATGTGGATTCCAGCAGGCCCTGG + Intronic
1019139878 6:169936493-169936515 CTGTGGGACCTGGCAGGTCCAGG + Intergenic
1019421283 7:952458-952480 AGCTGGGCCACAGCAGGTACAGG + Intronic
1019645204 7:2125213-2125235 AGGTGCACTCCAGCAGGTCCTGG + Intronic
1020099219 7:5385156-5385178 ATGCCTGCCCCAGCCGGTCCTGG - Intronic
1022304601 7:29135018-29135040 ACTTGGGCCCCAGGAGGTCAAGG + Intronic
1022532209 7:31074061-31074083 CTCTGGGCACCAGTAGGTCCTGG + Intronic
1023052723 7:36267316-36267338 ATGGGGGCCCCTGCATGGCCAGG + Intronic
1023658186 7:42447317-42447339 TTCTGGCCCCCAGCAGCTCCTGG - Intergenic
1024026368 7:45413240-45413262 ATGTGGACACCAGCCTGTCCTGG - Intergenic
1028563907 7:92206287-92206309 ATGTGGGCGCCAGCAGGCATAGG - Intronic
1028641269 7:93044295-93044317 ATGGGGCCTCCAGCAGGGCCTGG - Intergenic
1029075280 7:97929493-97929515 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1029172648 7:98641827-98641849 ATGTGGTCACCTGCAGGACCGGG - Intergenic
1029420018 7:100467517-100467539 ATCTTGGTCCCAGGAGGTCCTGG - Intronic
1031810370 7:126360511-126360533 ATGTGAGACCCAGCAGATCAAGG - Intergenic
1032334387 7:131011568-131011590 CAGTGGGGCCCAGCAGGTCTGGG - Intergenic
1033033337 7:137847196-137847218 AGGTGGGCGCCCGCCGGTCCTGG - Intergenic
1033824980 7:145178552-145178574 CTGTGGGCCCCTGGAGGTCCAGG + Intergenic
1034589757 7:152129145-152129167 ACCTGGGCCCCACCAGGCCCTGG - Intergenic
1034680064 7:152921875-152921897 ATGTGAGCCCCACCAGATCAAGG - Intergenic
1034833219 7:154328071-154328093 CTGTGAGCTCAAGCAGGTCCTGG + Intronic
1035166431 7:156993158-156993180 ATGGGGGTCCCTGCAGGTCTGGG - Intergenic
1036242247 8:7090885-7090907 AAGTGAGCACCAGCAGCTCCTGG - Intergenic
1036259596 8:7229271-7229293 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1036307021 8:7610253-7610275 AAGTGAGCACCAGCAGCTCCTGG - Intergenic
1036311639 8:7687841-7687863 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1036357869 8:8058240-8058262 AAGTGAGCACCAGCAGCTCCTGG - Intergenic
1036635026 8:10543270-10543292 ATGGGGCCCCCAGAAGCTCCGGG - Intronic
1036830492 8:12016245-12016267 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1036893080 8:12608706-12608728 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1036900641 8:12666692-12666714 AAGTGAGCACCAGCAGCTCCTGG + Intergenic
1037893373 8:22635998-22636020 AAGTGGGGGCCAGCAGGTGCTGG - Intronic
1041662821 8:60415525-60415547 ATGTAGGCCCACTCAGGTCCTGG + Intergenic
1046569721 8:115948083-115948105 ATGTAAGCCCCAGAAGGTCAAGG + Intergenic
1047510480 8:125511913-125511935 ATGTGAGCCCCAGCAGTGTCAGG - Intergenic
1048764750 8:137831799-137831821 ACCTGTGCTCCAGCAGGTCCTGG + Intergenic
1048972966 8:139655486-139655508 CTGTGACCCCCATCAGGTCCAGG + Intronic
1049156931 8:141073024-141073046 CTCTGGGCCCCTGCAGGTGCTGG + Intergenic
1049616002 8:143576013-143576035 CTGGGGGCCCCTGCAGGTTCTGG - Intronic
1049622549 8:143605153-143605175 ATGGGGGCCCCATCAGGCCAGGG + Exonic
1049725157 8:144142369-144142391 GTGTGGGCCCCTGCAGGTGGAGG + Intergenic
1049755549 8:144309915-144309937 TTATGGGCCACAGCGGGTCCTGG + Intronic
1052642357 9:31185131-31185153 ATGTGGGCACCATGAGGACCTGG + Intergenic
1055454552 9:76460129-76460151 ATGAGGGCGCCTGCAGATCCCGG + Intronic
1056307467 9:85304015-85304037 AGCTGGGCCCCAGCAGGTCTAGG - Intergenic
1057407453 9:94785990-94786012 ATGTGGGCCTCATCAGGTCGCGG + Intronic
1059684148 9:116618509-116618531 TTTTGGGCCCCAGCTGGTGCTGG - Intronic
1060135598 9:121150373-121150395 ATGGGGGCCCCAGCAGGAGGTGG - Exonic
1060219615 9:121757411-121757433 CTGGGGGCCCCAGCAGCTTCAGG - Intronic
1060302614 9:122384114-122384136 TTGTGGTCCCCAGCACGTGCAGG + Intronic
1060558343 9:124521827-124521849 AGGTGGGCCTCAGGAGATCCAGG + Exonic
1060745159 9:126126324-126126346 ATGTGGGCCCCCGAGGGTCCTGG - Intergenic
1061007761 9:127937919-127937941 AGGTGGGCCCGAGCAGGCCTGGG - Exonic
1061153328 9:128841926-128841948 ATGTGAGCCCCATGAGGTACAGG + Intronic
1061193289 9:129094499-129094521 CTGTGGGGCCCAGCAGGCCCAGG - Intergenic
1061730710 9:132611700-132611722 ATCTGGGCTTCAGCAGCTCCTGG + Intronic
1061861133 9:133469308-133469330 CTAGGGGCCCCAGCAGGCCCAGG - Exonic
1062206371 9:135339731-135339753 GTGTGTGTCCCAGCAGGCCCGGG + Intergenic
1062267695 9:135694954-135694976 AAGTGGGCCCAAGCAGGACTGGG + Intronic
1062288889 9:135785847-135785869 ATCTGGACCCCAGCACATCCTGG - Intronic
1062393172 9:136342141-136342163 ATGTGCCCCCCAGGATGTCCAGG + Intronic
1062393679 9:136343998-136344020 GTGAGGGCCCCAGCAGTGCCTGG - Intronic
1185793488 X:2945311-2945333 ATCTGGGCAGCAGCAGGTCATGG + Intronic
1185828642 X:3277035-3277057 ATCTGGGTGCCAGCAGATCCAGG - Intronic
1191615816 X:63168455-63168477 ATGTGCGCTCCAACAGGTCCTGG - Intergenic
1191620482 X:63210468-63210490 ATGTGCGCTCCAACAGGTCCTGG + Intergenic
1195791359 X:108591201-108591223 ATGTGAGGGCCAGCAGGGCCAGG - Exonic
1196082748 X:111649965-111649987 AGGTGGGCCCCAGCAGCTCCAGG - Intergenic
1197632475 X:128877368-128877390 GTGTGGGACCCAACTGGTCCAGG + Intergenic
1200056394 X:153463627-153463649 ATGTGGGCCCCAGAAGGACGTGG - Intronic
1200251386 X:154556096-154556118 ATGTGGGCCCAGGCAGGGCCCGG + Intronic
1200266381 X:154648320-154648342 ATGTGGGCCCAGGCAGGGCCCGG - Intergenic