ID: 927199930

View in Genome Browser
Species Human (GRCh38)
Location 2:20571819-20571841
Sequence AGTGGCACTGGGGAGATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927199930_927199941 12 Left 927199930 2:20571819-20571841 CCTGGTATCTCCCCAGTGCCACT 0: 1
1: 1
2: 0
3: 17
4: 180
Right 927199941 2:20571854-20571876 GGCCAGAATGCAGGCCACTCAGG 0: 1
1: 0
2: 3
3: 13
4: 176
927199930_927199937 -9 Left 927199930 2:20571819-20571841 CCTGGTATCTCCCCAGTGCCACT 0: 1
1: 1
2: 0
3: 17
4: 180
Right 927199937 2:20571833-20571855 AGTGCCACTGCCAAAGGGCTGGG 0: 1
1: 0
2: 2
3: 9
4: 177
927199930_927199936 -10 Left 927199930 2:20571819-20571841 CCTGGTATCTCCCCAGTGCCACT 0: 1
1: 1
2: 0
3: 17
4: 180
Right 927199936 2:20571832-20571854 CAGTGCCACTGCCAAAGGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 200
927199930_927199940 3 Left 927199930 2:20571819-20571841 CCTGGTATCTCCCCAGTGCCACT 0: 1
1: 1
2: 0
3: 17
4: 180
Right 927199940 2:20571845-20571867 AAAGGGCTGGGCCAGAATGCAGG 0: 1
1: 0
2: 4
3: 28
4: 281
927199930_927199943 20 Left 927199930 2:20571819-20571841 CCTGGTATCTCCCCAGTGCCACT 0: 1
1: 1
2: 0
3: 17
4: 180
Right 927199943 2:20571862-20571884 TGCAGGCCACTCAGGTGACATGG 0: 1
1: 0
2: 1
3: 23
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927199930 Original CRISPR AGTGGCACTGGGGAGATACC AGG (reversed) Intronic