ID: 927203062

View in Genome Browser
Species Human (GRCh38)
Location 2:20590421-20590443
Sequence CCTTCTCTGTAGAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927203059_927203062 -9 Left 927203059 2:20590407-20590429 CCTCTCAGGGCTGTCCTTCTCTG 0: 1
1: 0
2: 1
3: 32
4: 384
Right 927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG 0: 1
1: 0
2: 2
3: 18
4: 281
927203056_927203062 14 Left 927203056 2:20590384-20590406 CCTTCTATCACAGACTATCACAG 0: 1
1: 0
2: 1
3: 8
4: 146
Right 927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG 0: 1
1: 0
2: 2
3: 18
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927203062 Original CRISPR CCTTCTCTGTAGAAGGATGA TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900883218 1:5397238-5397260 CCTTCCCTGTATAAGTAGGATGG + Intergenic
904399518 1:30246984-30247006 CCTTCTCTGTAAAACTAGGATGG + Intergenic
905967842 1:42114255-42114277 CCTTGTCTGTAAAAGGCCGAGGG + Intergenic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908589216 1:65611469-65611491 CCTTCACTGTAGAAGTTTGCAGG - Intronic
909836355 1:80260225-80260247 CCTGCTCTGGAGCAGGATAAGGG + Intergenic
909929583 1:81480531-81480553 CTTTCTCTGTATAAGAAAGATGG + Intronic
912415587 1:109506481-109506503 ACTTCACGATAGAAGGATGAAGG - Exonic
913329305 1:117654001-117654023 CCTCCTCTGTAGTAGGAAGTAGG + Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914828069 1:151149886-151149908 TTTTCTCTGAAGACGGATGAGGG - Intergenic
915172995 1:153991129-153991151 CCTCTTCTGGAGAGGGATGAAGG - Exonic
915955365 1:160216210-160216232 CCTTCTTTATAGAAGAGTGAAGG - Exonic
916992519 1:170259580-170259602 CCCTCTTTGTAGACGGATGCAGG - Intergenic
917317595 1:173741695-173741717 CCTCTTCTGGAGAGGGATGAAGG - Intronic
917512970 1:175683452-175683474 CCTTTTTTGGAGAAGGATGGTGG - Intronic
918874418 1:190021061-190021083 TTTTCTCTGTAGGAAGATGATGG + Intergenic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
919182357 1:194103182-194103204 CCTACACTGGAGATGGATGATGG - Intergenic
919961287 1:202472075-202472097 CCTCTTCTGGAGAGGGATGAAGG + Intronic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
922137405 1:222843546-222843568 CCTTCTCTAATGAAGGATGGGGG + Intergenic
923652130 1:235883844-235883866 CCCTCTCTGCAGAAGAATCAGGG - Intergenic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1064269039 10:13848785-13848807 CCTTGGCTGAAGAAGGAAGATGG + Intronic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1069532484 10:69229565-69229587 CCTTGTCTGTATCAGGAGGAGGG - Intronic
1069702716 10:70438451-70438473 CCCTCTCTGTAAAAGGGAGATGG + Intronic
1070079779 10:73174714-73174736 GCTTCTCTGGAGGGGGATGATGG - Exonic
1072434510 10:95403075-95403097 ACTTCTCTGCAGAAGAACGATGG + Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1078062784 11:8059221-8059243 CCTTCTCTGTAGCAGGCTCAGGG + Intronic
1078651359 11:13196918-13196940 CCTGCTCTGGAGCAGGATAAGGG + Intergenic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080290661 11:30667404-30667426 CCTTCTCTGGAGAATGACAATGG - Intergenic
1080609566 11:33892234-33892256 CATTCTGAGTAGGAGGATGAGGG - Exonic
1081651729 11:44828429-44828451 CCTTACCTATAGGAGGATGAAGG + Intronic
1085044748 11:73346389-73346411 CTTCCTCTGTAGCAGGGTGATGG + Intronic
1086599499 11:88615481-88615503 CCTTCTCTGGTGGAGGAAGAAGG - Intronic
1087156227 11:94907557-94907579 TCTTCTCTGTAAATGGAAGATGG - Intergenic
1087729047 11:101757934-101757956 CCATGTATGTAGAAGCATGATGG - Intronic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1089236842 11:117036009-117036031 CCTTTTCTGGAGAGGGATGAAGG + Intronic
1089681574 11:120121761-120121783 CCTGCTCTGTAGGAGACTGAGGG - Intronic
1090273295 11:125402792-125402814 CCCCCTCTGAGGAAGGATGAAGG - Intronic
1090547917 11:127785476-127785498 CCTTCTGGGTAAAATGATGATGG + Intergenic
1091665176 12:2413750-2413772 CCTTCTCCGTGGAAGGACCATGG - Intronic
1091780547 12:3211875-3211897 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1095626849 12:44325269-44325291 TTTTCACTGTAGAAAGATGAAGG - Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1098876897 12:75875084-75875106 CTTTCTGTGAAGAATGATGATGG - Intergenic
1099162126 12:79255242-79255264 GCTTCTGTGTTGAAGGCTGATGG - Intronic
1099546695 12:83991249-83991271 GTTTTTCTGTAGAAAGATGATGG + Intergenic
1100375336 12:94010334-94010356 GTTTCTTTGTAGAAGCATGAGGG + Intergenic
1101208461 12:102512759-102512781 CCTTCTGTTTAGAAGGAGAAAGG - Intergenic
1102232083 12:111269687-111269709 TCTTCTCTCCAGAAAGATGAGGG - Intronic
1102895924 12:116598546-116598568 CCTTATCTGTACAAGGGTGGTGG - Intergenic
1103212329 12:119176096-119176118 CCTTCTCATTTCAAGGATGAGGG - Intergenic
1103364514 12:120371408-120371430 TCTCTTCTGGAGAAGGATGAAGG - Intergenic
1104724513 12:131067521-131067543 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724530 12:131067623-131067645 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724541 12:131067683-131067705 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724552 12:131067743-131067765 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724562 12:131067803-131067825 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724573 12:131067863-131067885 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724584 12:131067923-131067945 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1104724595 12:131067983-131068005 CCTGCTCAGAAGAAGGATCAGGG - Intronic
1105705289 13:22964512-22964534 CCTTCTCAGGAGAAGGCTGAAGG - Intergenic
1105858204 13:24389528-24389550 CCTTCTCAGGAGAAAGCTGAAGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1108572749 13:51767268-51767290 CCTTTTCTGCAGGAGGATGATGG - Exonic
1110736262 13:78940595-78940617 CCATCTCTGCAGGAAGATGACGG + Intergenic
1111294751 13:86264156-86264178 CCTTGTGTGTGGAAGGATGAGGG + Intergenic
1112445623 13:99461989-99462011 ACCTCTCTTTAGAAGGATAAGGG + Intergenic
1112683690 13:101797240-101797262 CCTTCTAGGTAGCAGGATGCTGG + Intronic
1113883784 13:113646655-113646677 CCTTCTCTTTGGAAGGATGGAGG + Intergenic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1118020230 14:61704638-61704660 CCTTCACTGTGAATGGATGAAGG + Intronic
1118333429 14:64832023-64832045 CCTTCTCTGTGGTTGGTTGATGG - Intronic
1119669273 14:76506369-76506391 CCTTCTCTGCAGAATGGTGGGGG + Intergenic
1122075906 14:99234369-99234391 CCTCCTCTGAGGAAGGATGGGGG - Intronic
1123904828 15:24911083-24911105 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1125591320 15:40856259-40856281 CCTTCTCTGCAGAATGATGAGGG - Exonic
1126682550 15:51216836-51216858 CCTTCACTTTAAAAGGATGTAGG - Intronic
1127003691 15:54541113-54541135 CCTTCTCTGGATAAAGAGGAAGG - Intronic
1127834664 15:62781128-62781150 TCTCCTCTGTAGCTGGATGAAGG + Exonic
1128761513 15:70219297-70219319 CCTTCTCAGTAAAAGGCTGGAGG - Intergenic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1130423731 15:83774745-83774767 CATGCTGTGTAGAAGAATGATGG + Intronic
1130907632 15:88251675-88251697 CCAACTCTGTAGAAGGACCAGGG - Intronic
1130997433 15:88911818-88911840 CCTTCCCTGGAGTGGGATGAAGG - Intronic
1131094641 15:89647702-89647724 CCTGCCCTATAGGAGGATGAGGG - Exonic
1131300406 15:91194786-91194808 CCCCCTCTGTGGAAGGATCATGG + Intronic
1131386798 15:92014759-92014781 CCTTCTCTGTGGAGGGAGAAGGG + Intronic
1131563604 15:93465312-93465334 CCTTCTGTGTAGAAGAAAAAGGG - Intergenic
1132291416 15:100706208-100706230 CCTTCTCTGGAGGTGGGTGAAGG + Intergenic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1135123996 16:19791583-19791605 CCTTGTGTGTGGAAGGATGAGGG - Intronic
1135494156 16:22937061-22937083 CCTTCTCAGTAGAGGAATGTTGG - Intergenic
1135747543 16:25029991-25030013 CATTCTCTGGAGGAGGAGGATGG - Intergenic
1136735585 16:32463513-32463535 AGTTCTCTGAAGAATGATGATGG + Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1138816344 16:60207172-60207194 CAATCTCTACAGAAGGATGAAGG - Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139610793 16:68056347-68056369 TTTTCTCTGGAAAAGGATGAAGG - Exonic
1140137628 16:72221630-72221652 CCTACTCTCGGGAAGGATGAAGG + Intergenic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141220221 16:82062621-82062643 CCTCCTCTGTAAATGGGTGATGG + Intronic
1203017493 16_KI270728v1_random:366058-366080 AGTTCTCTGAAGAATGATGATGG - Intergenic
1203035828 16_KI270728v1_random:639216-639238 AGTTCTCTGAAGAATGATGATGG - Intergenic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1146820847 17:35982738-35982760 CCTTATCTGTGGAAGGCTGGAGG + Intergenic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1147254717 17:39174895-39174917 CCTTTTCTCTAGGAGGGTGAGGG + Exonic
1148481456 17:47962182-47962204 CCTTCCCTGAAAAAGGATGTAGG - Intergenic
1148806877 17:50268359-50268381 CCTACACTTTAGAAGGATAATGG + Intergenic
1151996242 17:77611098-77611120 CCTTCTCGGTGGAGGGAGGATGG - Intergenic
1153097412 18:1423322-1423344 CCTTCTCTGTAAAATGGAGATGG + Intergenic
1153122798 18:1750833-1750855 CCTTATCTATAGAAGGACAAAGG + Intergenic
1153703299 18:7718030-7718052 ACTTCTGTGAAGAATGATGATGG - Intronic
1155177046 18:23310044-23310066 CCTTCCCTGGAGAGAGATGAGGG - Intronic
1155597061 18:27500454-27500476 CCTTCTCTGGAGACAAATGATGG + Intergenic
1155765733 18:29629943-29629965 CCTTCTTTGTAGAAGGGAGGAGG - Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157188063 18:45557599-45557621 GCTTCTCTGGAGTTGGATGACGG + Intronic
1157934548 18:51858659-51858681 CCTGCTCTGTACAAGACTGAAGG + Intergenic
1158149442 18:54351007-54351029 AGTTCTGTGAAGAAGGATGATGG + Intronic
1159365886 18:67464963-67464985 CCTTCTCTGAAGCAGGATAGAGG - Intergenic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1165610141 19:37144166-37144188 CCTTCTCAGGAGAAGTATTATGG + Intronic
1166654259 19:44598829-44598851 CCATCTCTACAGAAGGAAGAAGG - Intergenic
1166879661 19:45920115-45920137 GCTTGTCTGAAGAAGGATAAGGG - Intergenic
1168182316 19:54670721-54670743 CCCTTTCTGTAGGAGGAGGATGG - Intronic
1168369259 19:55818171-55818193 CCTTCCCTGGAGAAGCAAGATGG - Exonic
1168508146 19:56953500-56953522 CTTTCTCTGTAAAAGGAAAATGG + Intergenic
926753251 2:16216370-16216392 CCTTTTCTGTAAAATGATAATGG - Intergenic
927138531 2:20114448-20114470 CCGCCTCTGGAGAAGGATGATGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927562474 2:24083867-24083889 CCTTATCTGTAGAATTAAGATGG + Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928130497 2:28645684-28645706 CCTTCTCTGTAGAAAGGGAATGG - Intergenic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
929023571 2:37577575-37577597 CTATCTCTCTAGAAGGAGGAAGG + Intergenic
929107928 2:38382152-38382174 CCGTTTCTGTAGAATGCTGATGG - Intergenic
929522527 2:42667077-42667099 CCATCTCTTAAAAAGGATGAGGG - Intronic
930238465 2:48910347-48910369 ACTTCCCTGCAGAGGGATGATGG + Intergenic
931014630 2:57962204-57962226 CCTTATCTGTAGGATGAAGAGGG - Intronic
932594600 2:73086265-73086287 CCTTGTCTTTAGCAGGATGGAGG - Intronic
933521731 2:83382425-83382447 CCTTCTGTGAAGAATGATGTTGG - Intergenic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
936689974 2:114874906-114874928 CCTTCTCTCTAGTAGTATAAGGG - Intronic
937690689 2:124751413-124751435 CTTTGTCTGTACAAGGATTATGG + Intronic
938853645 2:135287445-135287467 ACTTCTGTGAAGAATGATGATGG + Intronic
938951247 2:136256672-136256694 CCTCCTCTGTTAAAGGTTGAAGG + Intergenic
939029690 2:137056769-137056791 CCTGTTCTGTAGGAGGCTGAAGG - Exonic
939835757 2:147127164-147127186 CATTCTGTGAAGAATGATGATGG + Intergenic
940806713 2:158195518-158195540 CCTTCTCTGTGGAATTATTAAGG + Intronic
941388019 2:164877262-164877284 CCTTCTCTTTGAAAGGTTGAGGG - Intergenic
943278594 2:185900516-185900538 CCTTCACTGTTGAAGTATTATGG + Intergenic
947172239 2:227323346-227323368 CCCTCCCTGTATAAGGAGGAAGG + Intergenic
947234017 2:227921064-227921086 CCTTCTCTGTGCAAAGATGCAGG - Intronic
1171115798 20:22523909-22523931 CCTTCCCTGGAGCAGGCTGAAGG + Intergenic
1172237946 20:33390687-33390709 CCTTCACTGTAGAAGCCTCAGGG - Intronic
1177200045 21:17944034-17944056 GCTTGACTTTAGAAGGATGATGG + Intronic
1179628935 21:42665037-42665059 CCCTCTCCTTAGAAGGATGGCGG - Intronic
1179824064 21:43954220-43954242 CCCTCCCTGCAGAAGGGTGACGG - Intronic
1180536975 22:16402420-16402442 AATTCTCTGAAGAATGATGATGG - Intergenic
1182235196 22:28869703-28869725 CCTTCTCTGTTGGTGGATGCAGG - Intergenic
1182713905 22:32340046-32340068 TCTTCCCAGTAGAAGGATGTCGG + Intergenic
1182882244 22:33743573-33743595 GCTTCTCTGTAAAAGTATGTTGG + Intronic
1183200879 22:36385511-36385533 ACTTCTCTCTCGTAGGATGAAGG - Intronic
1183697275 22:39430534-39430556 CCTGCTCTGTAGGAGGCTGCTGG - Exonic
1184246404 22:43237927-43237949 CCCTCTGTGCAGAAGGGTGAGGG - Intronic
949614674 3:5739771-5739793 CCTTTTCTGTACACAGATGAAGG + Intergenic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
951252686 3:20412426-20412448 CCTTTTCTGTGGTAGGATAAAGG + Intergenic
951959371 3:28299414-28299436 GCTTCTCTCTAGATGGATCATGG - Intronic
952804104 3:37330503-37330525 CCTTTTAGGTAGAAGGGTGAGGG + Intronic
953023155 3:39128819-39128841 CCAGCTCTGAAGAAGGAAGAAGG + Exonic
953199068 3:40761565-40761587 CCTCTTCTGGAGAGGGATGAAGG - Intergenic
953691578 3:45124398-45124420 CCTTCTCTGTCCAAGGAAGATGG + Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955265329 3:57437817-57437839 CCTTCCCTGTAGTAGGATTTTGG - Intronic
956252392 3:67248398-67248420 CTTTCTCTCAAGAAGGCTGAAGG - Intergenic
957972045 3:87394811-87394833 AATTCTCTGAAGAATGATGATGG - Intergenic
958182370 3:90076611-90076633 CCTTCTCTGTGTAAGGTTTATGG + Intergenic
958509765 3:95032739-95032761 ACTTCTGTGAAGAAAGATGATGG + Intergenic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
960357280 3:116669197-116669219 CTTTCTCCCTTGAAGGATGAAGG + Intronic
960435359 3:117619876-117619898 CCCTCTCTGTACGAGGGTGAGGG + Intergenic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
961766871 3:129218298-129218320 CTTTTTCTGCAGAAGGATGAGGG + Intergenic
962505151 3:136039218-136039240 TTTCCTCTGTAGAATGATGAGGG + Intronic
963383926 3:144567112-144567134 ACTTCTATGAAGAATGATGATGG - Intergenic
963428130 3:145158367-145158389 ACTTCTCTGTAGACCCATGAAGG + Intergenic
963519041 3:146342245-146342267 CTTTCTCTGTAGAAAGGTGTGGG + Intergenic
965492889 3:169361454-169361476 CCTTGACTTTGGAAGGATGATGG + Intronic
966587923 3:181648430-181648452 GGTTGTCTGTAGATGGATGAGGG + Intergenic
966756689 3:183377992-183378014 CCTTCTCTGAAGAAATAAGATGG + Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
968010049 3:195268697-195268719 CCTCCTCTGTTGAGGGGTGAGGG - Intronic
968259040 3:197304290-197304312 CCTTCTCTCTAAAAGAAAGATGG - Intergenic
969925737 4:10584101-10584123 CTTTTTCTGTAGAGGGATTAAGG + Intronic
971026526 4:22594216-22594238 CCTGTTCTGGAGAGGGATGAAGG - Intergenic
975099750 4:70499290-70499312 CGTTCTGTGAAGAATGATGATGG - Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
977763224 4:100765372-100765394 ACTTCTGTGAAGAATGATGATGG - Intronic
979418636 4:120475888-120475910 CCTTCTATATAGAAGGATGTTGG - Intergenic
981245530 4:142532580-142532602 CCTTCTCTTTTGAAGCTTGAAGG - Intronic
981522500 4:145678112-145678134 ACTTCTGTGAAGAATGATGATGG + Intergenic
981665188 4:147216154-147216176 CTTTCTCTGTATAATGATGTAGG - Intergenic
982163110 4:152589574-152589596 CCTTCTCGCTAATAGGATGAGGG + Intergenic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
983467932 4:168118157-168118179 CCTTCTGTGTATAAGGATTGAGG + Intronic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
985914458 5:2906930-2906952 CTGTCTCTGCAGAAAGATGATGG - Intergenic
989476377 5:41878647-41878669 ACTTCTCTGTAGGCGAATGAGGG + Intergenic
989689661 5:44125944-44125966 AGTTCTGTGGAGAAGGATGATGG - Intergenic
990350991 5:54915954-54915976 CCGTTTCTGTAGGAGCATGATGG - Intergenic
991718019 5:69469903-69469925 CCTATTCTGGAGAGGGATGAAGG - Intergenic
994513967 5:100746309-100746331 CAATCCCTGTAGAAGGATTAAGG - Intergenic
995481328 5:112595933-112595955 CCATCAGTGGAGAAGGATGATGG - Intergenic
996912935 5:128676293-128676315 CCTTCTCTGTGGAAGATTCAAGG + Intronic
997354688 5:133254729-133254751 CCTTCTCTGGAGAGTGATGGGGG + Intronic
999552847 5:152708225-152708247 CCTTTTCTGTAAAAAGATGGGGG - Intergenic
1001265692 5:170272960-170272982 GCTTTGCTGAAGAAGGATGAGGG - Intronic
1004449625 6:15733089-15733111 CCCTCTCAAGAGAAGGATGAGGG + Intergenic
1005814497 6:29539765-29539787 CTTTCTTTGTAGAATCATGAGGG + Intergenic
1007811836 6:44491759-44491781 CCATCTCTGGAGAAGGGAGAGGG + Intergenic
1010241321 6:73618363-73618385 CCTCTTCTGGAGAGGGATGAAGG - Intronic
1011979381 6:93353535-93353557 CTTTATCTGCAGAAGCATGAGGG - Intronic
1016080595 6:139850162-139850184 CATTCTCTTCAAAAGGATGAAGG - Intergenic
1018281308 6:162188424-162188446 CCTTCTTTGTGGAATGATGTTGG - Intronic
1019094656 6:169569034-169569056 CGTTCTCTGTTGATGGAAGAGGG - Intronic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1021636149 7:22695900-22695922 CCTTCTCTGTAGACTGATCTGGG + Intergenic
1021776257 7:24058053-24058075 CCATCTCTATAGGATGATGAAGG + Intergenic
1022560261 7:31340865-31340887 CCTTCTGTGTTGATGCATGAAGG - Exonic
1022857336 7:34328221-34328243 CCATATTTGTAGACGGATGATGG + Intergenic
1024493218 7:50010817-50010839 AGTTCTCTGAAGAATGATGATGG - Intronic
1027454063 7:78365326-78365348 CCATCCCTGGAGAAGAATGAGGG - Intronic
1030926682 7:115465784-115465806 CTTTCTCTGTAAAACGAGGATGG - Intergenic
1035644580 8:1209117-1209139 ACTTCTGTGAAGAATGATGATGG - Intergenic
1036192892 8:6687364-6687386 CCTTCTCTTTAGAAGCCTGGTGG + Intergenic
1036616025 8:10388333-10388355 CCCTCTCTGTACCAGGAAGACGG - Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1037931570 8:22883474-22883496 CCTTCCCTGGAGAGGGATGTGGG - Intronic
1038358974 8:26858678-26858700 CCTTCTCTTTCGTAGGTTGAAGG + Intronic
1040571170 8:48612649-48612671 ACCTCTCTGTAGCAGGGTGAGGG + Intergenic
1042413578 8:68492974-68492996 CCTTCTCTGTAAAATGTAGATGG + Intronic
1043684384 8:83068287-83068309 CCTTCTCTGTAGCAGAAAAAAGG + Intergenic
1044451240 8:92337744-92337766 AGTTCTCTGAAGAATGATGATGG - Intergenic
1045252372 8:100492685-100492707 CCGTCTCTGTGCAAGGAAGAAGG - Intergenic
1045675335 8:104601162-104601184 CCTTCTCTTAAGAAGAATGTAGG - Intronic
1045825224 8:106389035-106389057 TCTTCTTATTAGAAGGATGAGGG - Intronic
1046077288 8:109328314-109328336 CCTTCTCTGAAGAAAGAAAAAGG + Intronic
1047566725 8:126051922-126051944 CCTTCTGTGTAGGAAGAGGAGGG + Intergenic
1047842731 8:128771330-128771352 AGTTCTTTGTAGAATGATGATGG - Intergenic
1048492678 8:134908840-134908862 AGTTCTGTGTAGAATGATGATGG + Intergenic
1048497332 8:134946231-134946253 CGGTCTCTTTAGGAGGATGAGGG + Intergenic
1050045988 9:1545628-1545650 CCATCACTGGAGAAAGATGAAGG + Intergenic
1050720948 9:8588810-8588832 ATTTCTCTGAAGAAGAATGAGGG - Intronic
1051082982 9:13314154-13314176 CCTTCTCTGGTGAAGGTTGGTGG - Intergenic
1051132664 9:13879892-13879914 TCTTCTTTCTAGAAGGCTGAAGG - Intergenic
1051184052 9:14440027-14440049 CCTCCTCTGTAGAACGATCCAGG + Intergenic
1052262174 9:26529893-26529915 GCTTCTCTGTAGAAAGCTGTGGG + Intergenic
1053178619 9:35948129-35948151 CCTTTTCTGTAGTAGGTTAATGG + Intergenic
1057774271 9:97993247-97993269 CCTTCTCTGTAAATGGGGGAAGG + Intronic
1057920735 9:99094624-99094646 CCTTCTCTGATGATGGATGTAGG + Intergenic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186792703 X:13014429-13014451 ACTTATCTGCAGAAGGATAAGGG - Intergenic
1186816258 X:13240872-13240894 CCATCTCTGTAGAGGGAAGTGGG + Intergenic
1187400610 X:18956635-18956657 GCTTCTCTGTAGTTGAATGAGGG - Intronic
1187402768 X:18976331-18976353 CCTTCTCTGTAAAAGCATCTTGG + Intronic
1191770082 X:64745969-64745991 ACTTCTGTGAAGAATGATGATGG + Intergenic
1193551130 X:82893813-82893835 CATTCTCTGCACAAGGATGGTGG - Intergenic
1194554386 X:95338987-95339009 ACTTCTGTGAAGAATGATGATGG - Intergenic
1194581232 X:95674299-95674321 GCTTCTCTCTAGAAAGAAGAAGG - Intergenic
1194886963 X:99328083-99328105 CCTTCTCTCTCAAAGAATGAAGG + Intergenic
1195758198 X:108220064-108220086 CCTTATCTGTAGAAGCATAATGG - Intronic
1196898913 X:120364185-120364207 CCTCCTCTGTGGAAGGTTAAAGG + Intronic
1197878780 X:131142347-131142369 ACTTCTGTGAAGAATGATGACGG - Intergenic
1198267837 X:135026693-135026715 ACTTCTGTGAAGAATGATGAGGG - Intergenic
1198562096 X:137861428-137861450 CATTCTATGAGGAAGGATGAAGG + Intergenic
1199101870 X:143811393-143811415 AGTTCTCTGAAGAATGATGACGG + Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic