ID: 927203916

View in Genome Browser
Species Human (GRCh38)
Location 2:20595082-20595104
Sequence TAGCCTGCACAGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927203907_927203916 16 Left 927203907 2:20595043-20595065 CCCGGCATGCCACTTCCCTGAAT 0: 1
1: 0
2: 0
3: 16
4: 180
Right 927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 188
927203911_927203916 7 Left 927203911 2:20595052-20595074 CCACTTCCCTGAATGAGGGAGAC 0: 1
1: 0
2: 2
3: 23
4: 156
Right 927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 188
927203908_927203916 15 Left 927203908 2:20595044-20595066 CCGGCATGCCACTTCCCTGAATG 0: 1
1: 0
2: 0
3: 15
4: 220
Right 927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 188
927203912_927203916 1 Left 927203912 2:20595058-20595080 CCCTGAATGAGGGAGACATTCTT 0: 1
1: 0
2: 0
3: 21
4: 193
Right 927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 188
927203913_927203916 0 Left 927203913 2:20595059-20595081 CCTGAATGAGGGAGACATTCTTG 0: 1
1: 0
2: 0
3: 18
4: 142
Right 927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927203916 Original CRISPR TAGCCTGCACAGCTGGAGCA GGG Intronic
900002747 1:23842-23864 AAGCCAGCATGGCTGGAGCACGG - Intergenic
900022467 1:194367-194389 AAGCCAGCATGGCTGGAGCACGG - Intergenic
901829397 1:11883005-11883027 CAGCCTGCACGTCTGGAGCCTGG + Intergenic
905929472 1:41777093-41777115 TAGGCTGCCCAGCTGAAGCCAGG - Intronic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
909909266 1:81241650-81241672 TTTCCTGCAAAGCAGGAGCATGG - Intergenic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
910388827 1:86715590-86715612 TGGCTTACAAAGCTGGAGCATGG + Intronic
910528098 1:88204119-88204141 TAAGCTGCATAGCTAGAGCATGG + Intergenic
912546346 1:110454160-110454182 TAGCCTTCCTAGCTAGAGCAAGG - Intronic
912557956 1:110529874-110529896 GAGCCTGCCCAGCTGGTGCCTGG + Intergenic
914702161 1:150144733-150144755 TGGACTGCACAGCCGAAGCAAGG + Exonic
916730656 1:167563836-167563858 CTGCCTGCACAGCTGCATCAGGG - Intergenic
917120818 1:171643223-171643245 TTGCCTGCACAGGGGGAGAAGGG - Intronic
917247827 1:173023775-173023797 TATCTTGCAGGGCTGGAGCAAGG - Intergenic
920858825 1:209688154-209688176 TAGCCTGAATGGCTAGAGCAAGG - Intronic
922554772 1:226524253-226524275 TATCCTCCACATCTGGAGAAAGG - Intergenic
923199058 1:231694243-231694265 CAGCCTGCAGCGATGGAGCAAGG + Exonic
924197610 1:241624327-241624349 CAGTCTGCATGGCTGGAGCATGG - Intronic
924393835 1:243594717-243594739 TAGCCTGGACTGGTGGTGCAAGG - Intronic
1063450601 10:6147664-6147686 TAGCCTGCAGAGAGGGAGCTGGG + Intronic
1069982082 10:72259933-72259955 TTTCCTGCATAGATGGAGCAAGG - Intergenic
1070813344 10:79309341-79309363 TGGGCTGCACAGCTGGAGTGTGG + Intronic
1072521810 10:96236202-96236224 TAGCCTCCAGAGCAGGATCAGGG - Intronic
1076032710 10:127173120-127173142 TGGCCAGCAATGCTGGAGCAGGG - Intronic
1078121685 11:8516888-8516910 TAGACTCCACATCTGGGGCAGGG + Intronic
1080785441 11:35471031-35471053 GTGCCTGCCCAGGTGGAGCAAGG + Intronic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1083336300 11:61923743-61923765 CACCCTGCACAGCTGGCGGAGGG - Intergenic
1085011662 11:73145560-73145582 TTGCCTGCATTGCAGGAGCAAGG - Intergenic
1089340022 11:117750930-117750952 CAGACTTCACAGCTGGGGCAGGG - Intronic
1089672162 11:120064057-120064079 TGGTCTGGACACCTGGAGCAGGG + Intergenic
1090640121 11:128722877-128722899 CAGCCTGAACAGCTAGAACAGGG - Intronic
1091245484 11:134090604-134090626 TAGCCTGAACATCTGGATCCTGG + Intronic
1091376165 12:25905-25927 AAGCCAGCATGGCTGGAGCACGG - Intergenic
1092196585 12:6553290-6553312 TGTCCTGGACAGCTGGACCAAGG + Intronic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1095989314 12:48023462-48023484 TAGCCTTCACAGATGAGGCAAGG + Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1097119667 12:56721448-56721470 TAGGTAGCACAGCTGGAGAAAGG + Exonic
1101681867 12:106976170-106976192 CAGCCAGTACAGTTGGAGCAGGG - Intronic
1104031657 12:125069290-125069312 AAGCCTGCAGGGCGGGAGCAAGG - Intronic
1104793248 12:131497431-131497453 TAGCCTTCAAGGCTGAAGCAGGG - Intergenic
1104872409 12:132009446-132009468 GAGCCTGGCCAGCTGGAGCAAGG + Intronic
1105783629 13:23725926-23725948 GAGCCTGCACAGCAGGAGCGGGG + Intergenic
1106937160 13:34735651-34735673 TGGCCTGAACAACTGGAGAATGG - Intergenic
1107869291 13:44732393-44732415 CAGCCTGCACCCCTGGACCAGGG + Intergenic
1108168833 13:47720473-47720495 TAGCCTACACACCTGACGCATGG - Intergenic
1108323869 13:49311043-49311065 TGGCCTGCACTGCTGTAGCGTGG - Intronic
1108505133 13:51106348-51106370 TATCCTGCACACCTGGGCCAGGG - Intergenic
1109200678 13:59427380-59427402 TAGCCTGCATAGCCAAAGCAAGG + Intergenic
1115751713 14:36500131-36500153 GAGCCTGCTCAGCTGAAGCCAGG + Intronic
1115840600 14:37465390-37465412 TTGCCTGCATAGCTGGTGTATGG - Intronic
1115965902 14:38887916-38887938 GAGACTGCACAGCTGGTGGAGGG - Intergenic
1119526060 14:75323393-75323415 GAGCCAGGACAGCTGGAGCAGGG - Intergenic
1119678877 14:76576872-76576894 TAGCCCTCACAGCTGGAGGATGG + Intergenic
1119706004 14:76782979-76783001 CAGCCTACACAGCAGGAGCTGGG - Exonic
1119706814 14:76788264-76788286 CAGCCTGCAGAACTGGGGCAAGG - Exonic
1119969714 14:78956443-78956465 TAGCTTGAGCATCTGGAGCATGG + Intronic
1121940435 14:98065004-98065026 CAGCCTGCAGAGCTGGAGAAAGG + Intergenic
1122694851 14:103547542-103547564 CAGGCTGGACGGCTGGAGCAAGG - Intergenic
1124075265 15:26438062-26438084 CAGCCAGCCCAGCTGGAGTAAGG - Intergenic
1124496036 15:30187720-30187742 CAGCCTCAACAGCGGGAGCAGGG + Intergenic
1124747538 15:32350927-32350949 CAGCCTCAACAGCGGGAGCAGGG - Intergenic
1129661638 15:77556121-77556143 GAGCCTGCTCAGCTGCACCAGGG - Intergenic
1131300195 15:91192864-91192886 GAGCCTGCACAGCAGGTGCCTGG - Intronic
1132450764 15:101967097-101967119 AAGCCAGCATGGCTGGAGCACGG + Intergenic
1132953650 16:2579178-2579200 TAGTTGTCACAGCTGGAGCAGGG + Intronic
1132960701 16:2620989-2621011 TAGTTGTCACAGCTGGAGCAGGG - Intergenic
1133223745 16:4330432-4330454 TGGCCTGGCCAGCTGGGGCAGGG - Intronic
1134045862 16:11100404-11100426 CAGCTTTCACAGCAGGAGCAGGG - Intronic
1138240578 16:55424277-55424299 TAGCCAGCGCAGGTGGAGCAGGG - Intronic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1139566535 16:67780884-67780906 TAGAGAGCACAGCTGGAGAATGG - Intronic
1139914757 16:70421167-70421189 AAGACTGCTCAGCTGGAGCTCGG - Intronic
1145815702 17:27793638-27793660 CAGCCTGCACAGCCGGGGCCCGG + Intronic
1148907881 17:50922847-50922869 CAGCCTGCACAGGTGGGGCCAGG - Intergenic
1149557701 17:57585875-57585897 TCGTGTGCGCAGCTGGAGCAAGG - Intronic
1149993521 17:61395702-61395724 GAGGCGGCACAGCTGGAGCCCGG + Intergenic
1152502878 17:80724838-80724860 TTGCCTTTTCAGCTGGAGCACGG + Intronic
1152663937 17:81556501-81556523 CAGACTGCACAGGTGCAGCAAGG - Intergenic
1153456221 18:5285306-5285328 CAGCCTGTACACCTGAAGCAAGG + Intergenic
1156118621 18:33817064-33817086 TACCCTGCAGGGCTGGTGCAAGG + Intergenic
1156786526 18:40921771-40921793 TAGGCTGCACAGCAAAAGCATGG - Intergenic
1157084029 18:44559144-44559166 TAGACAGCACAGCTGGAGCTAGG - Intergenic
1160634498 19:65450-65472 AAGCCAGCATGGCTGGAGCACGG - Intergenic
1160949536 19:1658794-1658816 GAGCCTGCAAAGCTGGAACAGGG + Intergenic
1162110014 19:8394974-8394996 AAGGCTGTACAGCTGGGGCAAGG + Intronic
1162801445 19:13112908-13112930 CAGCCTGCACAGCTGCATCCAGG + Exonic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1163241067 19:16064285-16064307 CAGCCTGAACAGCTGGGGCAGGG + Intergenic
1166827909 19:45620983-45621005 GAGGCAGCACAGTTGGAGCAGGG + Intronic
925386925 2:3468361-3468383 CAGCCTGAGCAGCTGGACCAGGG - Intronic
925630215 2:5884321-5884343 TAGCATGAACAGCTGTAGAAAGG + Intergenic
925868332 2:8248032-8248054 TGGCCTGCACAGCAGGAGAGGGG - Intergenic
926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG + Intronic
927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG + Intronic
927512480 2:23653026-23653048 CAGCGTGCACGGCTGGGGCATGG - Intronic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
934060485 2:88287787-88287809 TAGCAAGAACAGCTGGAGGAAGG - Intergenic
935053613 2:99545571-99545593 TAGCCTGAAAAGCTGAATCAGGG - Intronic
936566977 2:113589577-113589599 AAGCCAGCATGGCTGGAGCACGG + Intergenic
937370456 2:121293921-121293943 AAACTTGCACAGCTGGAGGACGG + Intergenic
938404977 2:131027154-131027176 TTGGCTGTACTGCTGGAGCAGGG - Intronic
939392736 2:141589862-141589884 TAGGGTGCACATCTGGAGAAAGG + Intronic
940913297 2:159228011-159228033 TGGCCTTCACTGCTGGAGAAGGG - Intronic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
944951408 2:204753996-204754018 TAGTCTGCATAGCTGCAGCCAGG + Intronic
945218406 2:207459853-207459875 AAGCCTTTCCAGCTGGAGCAGGG - Intergenic
945650908 2:212558127-212558149 TACCCTGGACAGCAGGAGGATGG + Intergenic
948861667 2:240755534-240755556 GGGCCTGCACAGCTGCTGCATGG + Intronic
1171070414 20:22062766-22062788 CAGCTTGCCCAGCTGGGGCAAGG - Intergenic
1172005368 20:31815848-31815870 GTGTCTGCACAGCTGGTGCAGGG + Intergenic
1173016061 20:39226752-39226774 TGGCCTGCACAGCAGGACCCAGG - Intergenic
1174128343 20:48325127-48325149 TGGGCTGCACAGCTGGAAGAAGG - Intergenic
1174400636 20:50273975-50273997 CAGCCAGCAGGGCTGGAGCAGGG - Intergenic
1174451131 20:50621220-50621242 TTGCCTGCACAGGCAGAGCATGG - Intronic
1175520408 20:59599164-59599186 GAGCCTTCACTCCTGGAGCAGGG + Intronic
1179576256 21:42310246-42310268 TGCCCTGCACAGCTGGATTATGG + Intergenic
1179878199 21:44282045-44282067 CACCCGGCACAGCAGGAGCATGG + Intergenic
1180017408 21:45096393-45096415 GGGCCGGCACAGCTGGTGCAGGG - Intronic
1180709534 22:17830563-17830585 GAGCATGCACAGCTGGTCCAGGG - Intronic
1182009304 22:26986980-26987002 AAGCCAGCACAGCTGGAGTGGGG - Intergenic
1182084319 22:27551011-27551033 CAGCCTGCACAGGTGCAGCCTGG - Intergenic
1182107177 22:27697918-27697940 TAGTCTGCACCTCTGCAGCAGGG - Intergenic
1182125139 22:27810666-27810688 GGGCCTGCACAGCTGGGGCCTGG - Intergenic
1182300339 22:29333493-29333515 TGGGCTTCTCAGCTGGAGCAGGG + Intronic
1183453111 22:37907003-37907025 TCACCTGCACACCCGGAGCAAGG - Intronic
1184244337 22:43228332-43228354 GAGCATGCACTGCTGGAGCCGGG - Intronic
1184385507 22:44172142-44172164 TGGCCTGGACAGATGCAGCAAGG + Intronic
1184860938 22:47173066-47173088 GAGGCTGCAAAGCTGCAGCAGGG + Intronic
1185409828 22:50676029-50676051 AAGACTTCACAGCTGGAGAAAGG - Intergenic
949179256 3:1107641-1107663 TAGCCACCACACCTGGAGCATGG - Intronic
955940485 3:64142641-64142663 AAACCTGCACAGCTGGTGGATGG + Intronic
955966410 3:64393483-64393505 TAGCATGGACAGGAGGAGCAAGG + Intronic
956955878 3:74339197-74339219 TTGCCTGGACAGCTGGAGGGAGG - Intronic
957744166 3:84317241-84317263 TATCATGCAAGGCTGGAGCAAGG - Intergenic
963806190 3:149725479-149725501 TGGCCTGCACACCTAGAGCCTGG - Intronic
967801874 3:193670856-193670878 TAGATTCCATAGCTGGAGCAGGG + Intronic
967940080 3:194758908-194758930 TACCCAGAACAGCTGGAGCAAGG + Intergenic
968256771 3:197281327-197281349 GAGCCTCCACAGCTTGGGCACGG - Intronic
968279190 3:197462738-197462760 TGGCCAGCACAGCTGGAGCCAGG + Intergenic
968655263 4:1775821-1775843 TGGCCTGCCCAGCTGGAGCATGG - Intergenic
968902082 4:3436599-3436621 TGGCAGGCACAGCGGGAGCAGGG - Intronic
973955612 4:56060227-56060249 TGGCATGAACAGCTGGAGTAGGG - Intergenic
977929400 4:102734772-102734794 TGGACTGCACAGCTGGAGCCTGG - Intronic
979217601 4:118183925-118183947 TAGCCTGCACAGATGTACCACGG + Intronic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
982412672 4:155096884-155096906 TAGGCTGCACCACTAGAGCAGGG - Intergenic
985551769 5:537394-537416 TGGCCAGCACGGCTGGAGAACGG - Intergenic
986545189 5:8889443-8889465 TAGACTGCTTAGATGGAGCATGG + Intergenic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
988129059 5:27079605-27079627 TATCCTGCAAAGCTACAGCAGGG - Intronic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
989161823 5:38398648-38398670 GAGCCAGCACAGCTGGAGCACGG + Intronic
992502803 5:77358381-77358403 TACCCTGCAAAGAGGGAGCAGGG + Intronic
997432530 5:133850640-133850662 TATCCTCCACAGCTGGTTCAAGG + Intergenic
997587235 5:135050647-135050669 TTGCCAGCAGAGCTGGCGCAGGG + Intronic
999278694 5:150350069-150350091 TACCCTCCACAGGTGGAGGAGGG + Intergenic
999645874 5:153716594-153716616 CAGCCTGCTCAGCTGGAGTGAGG + Intronic
1007465249 6:42047298-42047320 TAGCCTGTGCAGATGGAGTATGG + Intronic
1007505673 6:42333542-42333564 CACCCTGCGCAGCTGGAGAAAGG + Intronic
1015647035 6:135403526-135403548 TGTCCTGCACAGATTGAGCAAGG - Intronic
1015699724 6:136022731-136022753 TTGCCTGCACTTCTGGGGCAGGG - Intronic
1015757068 6:136618356-136618378 TAGCTTGAACAGCTGGTGCAGGG - Intronic
1015926947 6:138320258-138320280 TAGCCTCCCCAGATGAAGCAGGG - Intronic
1016536841 6:145116508-145116530 TAGAGTTCACAGTTGGAGCAGGG - Intergenic
1018708056 6:166477100-166477122 TTGCCTGCGGAGCTGGAGCCAGG - Intronic
1018920518 6:168169106-168169128 TAGCCTGCACTGCTAGGGCGTGG + Intergenic
1020131299 7:5560032-5560054 TATACTGTACAGCTGAAGCATGG + Intronic
1022589865 7:31651303-31651325 CAGCCCACACACCTGGAGCAAGG + Intronic
1023043425 7:36192383-36192405 TAGCATGCCCAGATGGGGCAGGG + Intronic
1023390131 7:39701781-39701803 TAGCCACCAGAGCTGGGGCATGG + Intronic
1023527106 7:41116330-41116352 GAGACTGTAGAGCTGGAGCAGGG + Intergenic
1023987165 7:45103393-45103415 TACGCTGCACAGGTGGGGCAGGG + Exonic
1024348802 7:48341302-48341324 TAGCCTGCCCAGGTGGAGCATGG - Intronic
1030486594 7:110176519-110176541 TATCATGCATAGCTAGAGCATGG + Intergenic
1030894648 7:115042835-115042857 TGTCCTGCATGGCTGGAGCAAGG + Intergenic
1031365766 7:120899024-120899046 AAGCCTGCACATTTAGAGCATGG - Intergenic
1031894453 7:127332313-127332335 TAGCCTTCACAGCTGGGAAAAGG - Intergenic
1032192641 7:129773435-129773457 TTGACTGCACAGCAGGAACATGG - Intergenic
1032578612 7:133082031-133082053 TTTCCCGCACAGCGGGAGCAAGG + Exonic
1033274198 7:139958853-139958875 TAGGCTTCAGAGCTGGGGCAGGG - Intronic
1033566438 7:142583004-142583026 TAGGCCTCACAGCTGGAGCTGGG + Intergenic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034187319 7:149188546-149188568 TAGCCTGCTTTACTGGAGCAGGG + Intergenic
1034276539 7:149826332-149826354 TACCCCCCACAGCTGGGGCAGGG - Intergenic
1034716563 7:153248289-153248311 CAGCCTGCACAGCAAAAGCACGG + Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1040279003 8:46028512-46028534 TATCCCGCGCAGCTGCAGCATGG + Intergenic
1041110335 8:54477231-54477253 CAGCCTGAGCAGCTGGAGCAGGG + Intergenic
1043698398 8:83251488-83251510 GAGCCTGCCAAGCTGGTGCATGG + Intergenic
1044559271 8:93596585-93596607 TGACCTGGACAGCTGGACCATGG - Intergenic
1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG + Intergenic
1044850101 8:96419490-96419512 TAGCCTGCGCCGCTGGGGGAAGG - Intergenic
1045083193 8:98650890-98650912 TAGGCTGCACCTCTGGAGGAAGG + Intronic
1049229388 8:141474206-141474228 GAGCCTGTACAGCAGGACCATGG - Intergenic
1049885552 9:23955-23977 AAGCCAGCATGGCTGGAGCACGG - Intergenic
1050120521 9:2302730-2302752 GAGCCTATAGAGCTGGAGCAAGG - Intergenic
1052218919 9:25997017-25997039 CAGCCTGCACAGGTGGGGCATGG - Intergenic
1058595627 9:106612368-106612390 GAGCCTGCAAAGATGGAGAATGG - Intergenic
1059782904 9:117548736-117548758 TAGCCAGCACCACAGGAGCAGGG + Intergenic
1060292377 9:122315674-122315696 GAGCCGGCCCAGCTGGAGCCAGG - Intronic
1060804938 9:126569376-126569398 TAGCTTGCAGGGCTGGGGCAAGG - Intergenic
1061400303 9:130364879-130364901 GGGCCTGCACACCTGCAGCAAGG - Intronic
1189545224 X:42035811-42035833 GAGCCTTCAGAGCTGGAGCGTGG - Intergenic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1200052565 X:153442780-153442802 TCGGCTGCCCAGCTGGAGCCTGG + Intergenic