ID: 927206017

View in Genome Browser
Species Human (GRCh38)
Location 2:20611103-20611125
Sequence CTCTAACAGACATACCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927206017 Original CRISPR CTCTAACAGACATACCACAA TGG (reversed) Intronic
901337144 1:8460254-8460276 CTCAAGCAGACATTCCAAAAAGG + Intronic
902964433 1:19988699-19988721 TTCTAACAGAGGTACCACAATGG - Intergenic
907547204 1:55272565-55272587 TTCTAACAGATATACCACTCTGG - Intergenic
910142695 1:84043799-84043821 ATCTAACAGACATATTACAATGG - Intergenic
911806706 1:102219238-102219260 TTCTAACAAACATACCACTCTGG + Intergenic
915069092 1:153251282-153251304 CTCTCACACACATACCAAAAGGG + Intergenic
917417876 1:174830171-174830193 CTGTTTCAAACATACCACAAGGG + Intronic
917547745 1:175989590-175989612 CTCTAACAGCCAGAAAACAAAGG + Intronic
919027323 1:192192564-192192586 CTTTAACAGAAATACTACAGTGG + Intergenic
920628476 1:207627426-207627448 CACTAACAGTGTTACCACAAGGG + Intronic
924018311 1:239752320-239752342 CTCTGACAGAAATAGAACAATGG - Intronic
1063529521 10:6817893-6817915 CTCTTTCAGCCATACCAGAATGG + Intergenic
1066226868 10:33392363-33392385 CTCTAACAGCCATGTCAGAACGG - Intergenic
1070991990 10:80740750-80740772 CTCTAAGAGAGGTACCACAAGGG + Intergenic
1071761697 10:88615664-88615686 CCCTAACATACATACTAGAATGG + Intergenic
1073087021 10:100898514-100898536 CTCTAACAGAGTTAAGACAAAGG - Intergenic
1077238084 11:1492882-1492904 ATTTAACAGAGATTCCACAATGG + Intronic
1079646576 11:22870466-22870488 ATATAACAGTCATACCAAAAAGG - Intergenic
1079797537 11:24824424-24824446 CCCTAACAGAAATACCTCCAAGG - Intronic
1080297264 11:30744649-30744671 ATCTGACAGACATAAAACAAGGG + Intergenic
1080521708 11:33073115-33073137 TTCTAACAAAAATACCAGAAGGG - Exonic
1088287861 11:108206496-108206518 CTGGATCAGACATACCACAGTGG + Intronic
1089131705 11:116217589-116217611 CTCCAGCATACATCCCACAAGGG + Intergenic
1091551413 12:1537919-1537941 CTAAAACAGAAACACCACAAGGG + Intronic
1093720353 12:22435657-22435679 CTTGAACAGACATATCACCAAGG + Intronic
1097371504 12:58787218-58787240 CTGTAAAAGACATATTACAAGGG - Intronic
1098478397 12:70933582-70933604 GTCTAAAAAACAAACCACAATGG - Intergenic
1100008273 12:89921044-89921066 CTGTAACAGAAATAACATAAAGG - Intergenic
1100076426 12:90790162-90790184 CTCTAACAGATGTACCACTCTGG + Intergenic
1102605778 12:114066190-114066212 CTTTGAAAGAGATACCACAAGGG + Intergenic
1106813533 13:33383160-33383182 GTCTCACAGACATGCCACATGGG + Intergenic
1107171283 13:37344931-37344953 TTTTAAAAGACATACCAGAATGG + Intergenic
1108844842 13:54665212-54665234 ATGTACCAGACATACCACTAGGG + Intergenic
1112962735 13:105147555-105147577 CTGTAACAGTCATACCACCAAGG + Intergenic
1114491588 14:23105693-23105715 ACCTAACAGACCTAACACAACGG - Intergenic
1115749055 14:36469940-36469962 CTCCAGCAGCCATACCAAAATGG - Intergenic
1118178621 14:63468312-63468334 CACAACCAGACATACCAAAAAGG - Intronic
1120806546 14:88757662-88757684 TTTTAACAGACATACCCCCAAGG + Intronic
1125830643 15:42714811-42714833 ATTTCACAGACATACCAAAATGG - Intronic
1127073688 15:55306531-55306553 CCCTATCAGACATACCAGTATGG + Intronic
1128556224 15:68633749-68633771 CTCTAACAGAGATACTACAACGG + Intronic
1133665256 16:7961024-7961046 CTCTAACAGTCAAACCCCCAGGG - Intergenic
1135685003 16:24491790-24491812 CTCTAGAAAACATCCCACAATGG + Intergenic
1138944549 16:61832165-61832187 CTTGCACAGATATACCACAAAGG + Intronic
1139159693 16:64489529-64489551 GTCTAACAAACATCCCACAGAGG - Intergenic
1139267353 16:65652429-65652451 CACTCACATACATACCACATGGG - Intergenic
1144589863 17:16514844-16514866 CACTAACAGACATAAAACATGGG - Intergenic
1151002598 17:70395577-70395599 GCCTTACAGACATTCCACAAAGG + Intergenic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1153894006 18:9542908-9542930 CTCTACCAGAAATTCCAAAATGG - Intergenic
1156954570 18:42946364-42946386 TTGTAACAGACCTACCACAAAGG - Intronic
1157423846 18:47568536-47568558 CACAAACAGTCATAACACAAGGG + Intergenic
1158534450 18:58295069-58295091 CTGTAACAAACATACCACTCTGG - Intronic
1158739461 18:60123222-60123244 CTCTGAAAAACAAACCACAATGG - Intergenic
1158983158 18:62785452-62785474 CTCTAATAGCCACAGCACAAAGG - Intronic
1159541081 18:69777585-69777607 CATTAACAGACCTATCACAAAGG + Intronic
1162863823 19:13528633-13528655 GTCCAACAGAAATACAACAAGGG - Intronic
1162863900 19:13529158-13529180 CTCCAACAGAAATACAACAAGGG - Intronic
927206017 2:20611103-20611125 CTCTAACAGACATACCACAATGG - Intronic
927724651 2:25412194-25412216 CTCTACCAAATATACCTCAAAGG - Intronic
927912257 2:26908050-26908072 CTTTTAAAGACATACGACAATGG - Intronic
928820431 2:35355319-35355341 TTGGACCAGACATACCACAAGGG + Intergenic
929133276 2:38599907-38599929 CTTTAACAGTCTGACCACAAAGG + Intronic
929984279 2:46711425-46711447 CTTGAACAGACATATCACTAAGG - Intronic
931678966 2:64727156-64727178 CTTTAACAGAAAGAACACAATGG + Intronic
932033537 2:68215709-68215731 CACCAACAAACATACTACAATGG + Intronic
932466095 2:71925412-71925434 CTCCACCAGACATACCCCCAGGG + Intergenic
936033629 2:109091872-109091894 TACAAACAGACATCCCACAATGG - Intergenic
939825483 2:147010325-147010347 TTCAAACAAACATACCTCAAGGG + Intergenic
943287428 2:186020663-186020685 CTCGAACAGACATTTCTCAAAGG - Intergenic
944794043 2:203163912-203163934 CTTGAACAGACATTTCACAAAGG - Intronic
945547686 2:211176921-211176943 CCTTAACAGACATACCCCAGAGG + Intergenic
948089366 2:235279650-235279672 CTCTCACAGTCTTACCACATGGG + Intergenic
1175481124 20:59311823-59311845 CTCTGACAGAGCTACCAAAAGGG + Intronic
1175832756 20:61975986-61976008 CTGTAACAGAGAGAACACAAAGG - Exonic
1182299546 22:29329976-29329998 CTCTAACAGGTCTACCTCAAAGG + Intronic
949553103 3:5128945-5128967 ATCCACAAGACATACCACAATGG - Intronic
949722157 3:7002226-7002248 ATCAAACAGACCTGCCACAAAGG + Intronic
951071710 3:18337032-18337054 CTGTAACAAACATACCACTGTGG - Intronic
951391995 3:22117024-22117046 CTCTAACAGATATACCATCCTGG - Intronic
951535774 3:23739215-23739237 CTCTAATAGAAAGACCAGAAGGG - Intergenic
953872393 3:46638578-46638600 CTCTAACAGGAAGACCATAATGG + Intergenic
955821241 3:62898008-62898030 CTATCACAGACATACTACAAAGG + Intergenic
956175659 3:66471108-66471130 CTCCCACAGACCTGCCACAAAGG + Intronic
959344401 3:105174516-105174538 CTCTGACTGCCATACAACAACGG + Intergenic
960140258 3:114145052-114145074 CTCTCACAGACACACCACACTGG - Intronic
961096032 3:124157744-124157766 CTTTATCAGAAATACCACACAGG - Intronic
961247694 3:125470581-125470603 CTCGAACTGAAAAACCACAAGGG + Intronic
961250198 3:125496631-125496653 CCCTAAAAGAAATACAACAAAGG - Intronic
963544398 3:146637150-146637172 CTTTTTCATACATACCACAAGGG - Intergenic
963928488 3:150977219-150977241 CTCTAAGAGAGATTCAACAAGGG + Intergenic
971068412 4:23061712-23061734 ACCTAGCAGACATTCCACAAAGG - Intergenic
973155708 4:46949275-46949297 CTGTAATAGACATACTATAATGG - Intronic
974048936 4:56921875-56921897 TTCTAGTAGTCATACCACAAAGG - Intronic
977503174 4:97866624-97866646 CTGTATCACACATACCAAAAAGG - Intronic
983885263 4:172974604-172974626 CTCTACCAAAGATACCACAGAGG - Intronic
986394318 5:7313802-7313824 CTCTATCAGCCCCACCACAAGGG + Intergenic
988114500 5:26867227-26867249 TTCTAAAAGATATCCCACAACGG - Intergenic
991297483 5:65096749-65096771 AATTAACAGACATACAACAATGG + Intergenic
992367686 5:76110110-76110132 TTCTAACATGCATACCCCAAAGG + Intronic
992862807 5:80929301-80929323 CTCTAACAGGCATATTCCAATGG + Intergenic
995483029 5:112611559-112611581 CTGTAACAGACATACAAATATGG + Intergenic
996357292 5:122610578-122610600 CCCCAACAGACAAACCATAATGG - Intergenic
1002820897 6:723814-723836 CTCCAGCAGACATACAACATGGG - Intergenic
1008410283 6:51170491-51170513 ATCTAACAGACATTTCTCAAAGG - Intergenic
1009957823 6:70477270-70477292 CTGTAACAGACACAACAGAAAGG - Exonic
1010475601 6:76283079-76283101 CTCCAACAGACCTGCCACAAAGG - Intergenic
1011793601 6:90927657-90927679 CTTTAAGAGAAATTCCACAAAGG - Intergenic
1012651576 6:101761253-101761275 CAGCACCAGACATACCACAAAGG - Intronic
1015151293 6:130041444-130041466 CTCTAACATACAGATCACATTGG + Intronic
1018436369 6:163762783-163762805 CCCTAAGAGGCATACAACAAAGG - Intergenic
1022155050 7:27652548-27652570 CTATAACAAATATACCATAATGG + Intronic
1024429261 7:49267083-49267105 GACTAATAGACATACCACATAGG - Intergenic
1027623710 7:80523239-80523261 CTCTAGCAAAGATACCACAATGG + Intronic
1028598767 7:92577567-92577589 TTCTAACAGATATTTCACAATGG + Intronic
1028897328 7:96056637-96056659 CTCTAACAGGCATTTCTCAAAGG + Intronic
1033667130 7:143452186-143452208 CTCCAACACACAGACCACATGGG + Intergenic
1037339544 8:17829504-17829526 CTGTAATAGACACACAACAAAGG + Intergenic
1039165569 8:34675831-34675853 CTTTAATAGAGATACAACAAAGG - Intergenic
1044212134 8:89562306-89562328 GTCTAACAGAAATGCCTCAAGGG - Intergenic
1045133224 8:99181978-99182000 CTTGAACAGACATTTCACAAAGG + Intronic
1046652658 8:116855096-116855118 CCCTGTCAGACATACCCCAAAGG + Intronic
1059990068 9:119856569-119856591 CTATAAAAGAGATATCACAATGG - Intergenic
1186714399 X:12234941-12234963 CTCAAAATGAGATACCACAAGGG - Intronic
1187041403 X:15599846-15599868 GTCAACCACACATACCACAATGG + Intronic
1188953606 X:36407560-36407582 CTGTAACAGACACAGTACAAAGG - Intergenic
1192130991 X:68549787-68549809 CTCTAAGAGACAAACCATAGTGG - Intergenic
1194779667 X:98009642-98009664 CTTGAACAGACATTTCACAAAGG - Intergenic
1195731352 X:107971190-107971212 CCCAAACAGAAATACAACAAAGG - Intergenic
1196310214 X:114155375-114155397 CTCTAAAAGACATAGCAACATGG - Intergenic
1202083161 Y:21105691-21105713 AGGTAACAGACATACAACAATGG + Intergenic