ID: 927206635

View in Genome Browser
Species Human (GRCh38)
Location 2:20615304-20615326
Sequence GCTGCTTCACAGGATGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927206625_927206635 24 Left 927206625 2:20615257-20615279 CCAAGCTGGACTGGAACCCTGGC 0: 1
1: 0
2: 4
3: 61
4: 690
Right 927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG 0: 1
1: 0
2: 4
3: 23
4: 230
927206626_927206635 8 Left 927206626 2:20615273-20615295 CCCTGGCCGTTTGTGCCCACAGA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG 0: 1
1: 0
2: 4
3: 23
4: 230
927206630_927206635 -7 Left 927206630 2:20615288-20615310 CCCACAGAACCTGGCTGCTGCTT 0: 1
1: 0
2: 4
3: 26
4: 272
Right 927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG 0: 1
1: 0
2: 4
3: 23
4: 230
927206627_927206635 7 Left 927206627 2:20615274-20615296 CCTGGCCGTTTGTGCCCACAGAA 0: 1
1: 0
2: 0
3: 7
4: 90
Right 927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG 0: 1
1: 0
2: 4
3: 23
4: 230
927206631_927206635 -8 Left 927206631 2:20615289-20615311 CCACAGAACCTGGCTGCTGCTTC 0: 1
1: 0
2: 6
3: 56
4: 455
Right 927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG 0: 1
1: 0
2: 4
3: 23
4: 230
927206628_927206635 2 Left 927206628 2:20615279-20615301 CCGTTTGTGCCCACAGAACCTGG 0: 1
1: 0
2: 0
3: 17
4: 230
Right 927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG 0: 1
1: 0
2: 4
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927206635 Original CRISPR GCTGCTTCACAGGATGCTGT GGG Intronic
900743508 1:4344596-4344618 GAGGCCTCACAGGCTGCTGTCGG - Intergenic
901148434 1:7084338-7084360 GCTGCTCCAGGGGAAGCTGTGGG + Intronic
901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG + Intronic
901784862 1:11617805-11617827 CCTGCTTGCCAGGATGATGTGGG - Intergenic
902712404 1:18249445-18249467 GCTGCTTCACCAGATGCAGAAGG + Intronic
902712596 1:18250411-18250433 GCTGCTTCACCAGATGCAGAAGG - Intronic
904303531 1:29571791-29571813 TCTGCTTCATAGGATGCTGTGGG + Intergenic
904428282 1:30445808-30445830 TCCGCTTCCCAGGATGATGTGGG - Intergenic
904565008 1:31423715-31423737 GCAGCTGCACAGGATGCAGGGGG - Exonic
905090067 1:35423569-35423591 GCTGCTTCAGAGGCTGATGCAGG + Intergenic
906427747 1:45727159-45727181 GCTACTTGAGAGGATGATGTGGG - Intronic
910037249 1:82803247-82803269 GCTGCTACTCAGGAGGCTGAGGG + Intergenic
910261659 1:85298946-85298968 GGTGCTCCCCAGGACGCTGTTGG - Intergenic
911730549 1:101287985-101288007 GCAGCTACACAGGAGGCTGAGGG + Intergenic
911989320 1:104672281-104672303 GCTGCTTGACAGGGTGGTTTGGG + Intergenic
912511544 1:110193470-110193492 CCTGGTTCCCAAGATGCTGTGGG - Intronic
912692892 1:111818165-111818187 GCTGCTACAAAAGATGCAGTTGG + Intronic
913552517 1:119929443-119929465 GCTACTTCACTGGATTGTGTGGG - Intronic
915041532 1:152971944-152971966 GCTGCTTCACTTGCTGCTGCTGG - Exonic
915276020 1:154788702-154788724 GCTGGCTCACAGGAGGCTGTGGG - Intronic
916499364 1:165373741-165373763 TCTGTTTCACAGGGTGCTGGAGG + Intergenic
916602301 1:166304856-166304878 CCTGGCTCACAGGATTCTGTAGG + Intergenic
916883545 1:169045647-169045669 GCTGCCTCACTGGATGCTGGAGG - Intergenic
918754664 1:188324261-188324283 GTTGCTTGACACGATGCTGAAGG + Intergenic
919969525 1:202565177-202565199 GATGCTTTAGAGGATGCTGGAGG + Intronic
921216470 1:212941700-212941722 GCTGCTTCAAAGGAAGTTGTTGG + Intergenic
921289937 1:213648214-213648236 GCAGACTCACAGGCTGCTGTGGG - Intergenic
921318484 1:213914759-213914781 GCTGATTCACTGGGTGCTCTGGG + Intergenic
924719912 1:246612771-246612793 GCTACTTCAGAGGCTGCAGTGGG + Intronic
1064276492 10:13910853-13910875 GAGGCTTAACAGGATGGTGTTGG - Intronic
1064719963 10:18219051-18219073 GCTGCTTCAGAGGCTGAAGTAGG + Intronic
1065922338 10:30403603-30403625 GCTGGTTTACTGGATGCTGGAGG - Intergenic
1066678819 10:37916476-37916498 GCTACTTGAGAGGATGATGTGGG + Intergenic
1066746345 10:38605933-38605955 GCTGCCACACAGGGTGCTGCTGG + Intergenic
1069858801 10:71457486-71457508 GCTGCCTCCCAGGATTGTGTAGG + Intronic
1072849843 10:98877854-98877876 TGTTCTTCACATGATGCTGTGGG + Intronic
1073453482 10:103622931-103622953 GCTGATTCCCAGGAGGGTGTGGG + Intronic
1074697008 10:116058788-116058810 GTTGCTTCTCAGGATACTGATGG + Intronic
1075428943 10:122364646-122364668 GCTGTTGCAAAGGGTGCTGTTGG - Intergenic
1077135997 11:999025-999047 TCTGGTGCACAGGCTGCTGTGGG + Intronic
1078433410 11:11304844-11304866 GCTCCTTTCCAGGATGCTGCAGG - Intronic
1079754130 11:24234723-24234745 ACAGCTTCACAGGCTGGTGTGGG - Intergenic
1080944513 11:36956526-36956548 CCTGCTTCATGGGATGCTGAAGG + Intergenic
1083886938 11:65577531-65577553 GCTGAGTCACAGGCGGCTGTGGG + Intronic
1083939313 11:65887043-65887065 GCTGCTACCCAGGAGGCAGTGGG + Intronic
1084281635 11:68099562-68099584 CCTGCTTCACAGCTTGCTTTGGG - Intronic
1084894313 11:72254358-72254380 GCAGCTTCAGAGGATTCAGTAGG + Intergenic
1085054059 11:73393966-73393988 GCTGCCTCACAGGCTCCTGGAGG - Intronic
1085352569 11:75809088-75809110 CCTACTTCACAGGATCCTGTGGG + Intergenic
1087237889 11:95740551-95740573 GCTGCTAAACTGAATGCTGTAGG - Intergenic
1089231502 11:116981366-116981388 GCTTCTTCAGAGTATGCTGATGG + Intronic
1093945400 12:25102513-25102535 GCAGCTTCACAAGATCCTGAGGG + Intronic
1095981334 12:47976413-47976435 GCTGCTTCTGGGGAAGCTGTGGG - Intronic
1096385254 12:51191009-51191031 GATTCTCCACAGGATGCTGGAGG + Intronic
1096513695 12:52145313-52145335 TCTGCTTCCCAGGAAGCTGCTGG - Intergenic
1099070152 12:78036215-78036237 GCTGCTGCAGTGGATGCTGCTGG - Intronic
1100085145 12:90901515-90901537 ACTGCTTCACAGGAAGTTGTTGG + Intergenic
1104788591 12:131467814-131467836 GCTGCTTGAGAGGCTGATGTGGG - Intergenic
1106409128 13:29498905-29498927 GCTGCTCCACAGGCAGCCGTAGG - Intronic
1107036433 13:35907272-35907294 GCTGCTTCAGAGGCTGAGGTGGG - Intronic
1107791397 13:44005701-44005723 GCTGCCTGACAGGCTGCTCTTGG - Intergenic
1109659877 13:65443301-65443323 GATAGTTCACAGGTTGCTGTGGG + Intergenic
1111962922 13:94831206-94831228 GCTACTTGACAGGATGAGGTGGG + Intergenic
1112617267 13:101018391-101018413 GCTGGGTCACAGGTTGCTGAAGG + Intergenic
1114684044 14:24511023-24511045 GCTGCTTCCCAAGATGCTGTAGG - Intergenic
1117497393 14:56319080-56319102 GCTTCTTCAAAGGTTGCAGTAGG - Intergenic
1118009157 14:61591991-61592013 GCTGTTTCACAGGGAGATGTGGG - Intronic
1121365345 14:93303927-93303949 GCTCCTGCACTGGCTGCTGTAGG - Intronic
1121883152 14:97518197-97518219 GCTGGATCATAGGATGCTATTGG + Intergenic
1124048353 15:26172150-26172172 GCTGCTGCACAGTGTACTGTAGG - Intergenic
1124349916 15:28947650-28947672 TCTGGTTCCCAGGAGGCTGTGGG - Intronic
1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG + Intergenic
1125665751 15:41428849-41428871 CCAGCTACACAGGAGGCTGTGGG - Intronic
1126463306 15:48936819-48936841 GCTGCCTCACGGGATGCAGATGG - Intronic
1127378812 15:58410074-58410096 GATCCCTCAGAGGATGCTGTAGG - Intronic
1129468951 15:75739575-75739597 GCTGCTCCACAGGCTGACGTTGG - Intergenic
1129513374 15:76140923-76140945 GCTGCTTCAGAGGCTGAAGTGGG + Intronic
1136061570 16:27730160-27730182 CCTTCTTCTCAGGATGCTCTGGG - Intronic
1136232548 16:28895088-28895110 GCTTCTCCACAGGCTGATGTGGG + Intronic
1136577265 16:31132117-31132139 GCTGCCACAGAGGTTGCTGTCGG + Exonic
1136736714 16:32473709-32473731 GCTGCCACACAGGGTGCTGCTGG - Intergenic
1140486145 16:75295199-75295221 GGTACTTCCTAGGATGCTGTTGG - Intronic
1141122678 16:81373195-81373217 GCTGCTTCACAGCATAGAGTAGG + Intronic
1203016354 16_KI270728v1_random:355868-355890 GCTGCCACACAGGGTGCTGCTGG + Intergenic
1203034689 16_KI270728v1_random:629026-629048 GCTGCCACACAGGGTGCTGCTGG + Intergenic
1143045772 17:4078100-4078122 GCTGCTTTAGAGGATGCCCTTGG - Intronic
1143353238 17:6305320-6305342 TCTACCTCACAGGATACTGTAGG - Intergenic
1144672167 17:17138960-17138982 GCTGCTTCACAGGTTGCCTCAGG - Intronic
1145209784 17:21004484-21004506 GCTGATGCACAGGAGGCTGCAGG + Intronic
1147125083 17:38361850-38361872 GATGCATCACAGGGAGCTGTAGG + Intronic
1147407117 17:40219899-40219921 GCTAATTAGCAGGATGCTGTGGG + Intronic
1150103556 17:62444825-62444847 GCTGCTCCACAGGATGCAGAAGG + Exonic
1150309838 17:64119060-64119082 GCTCCTTCACAGTATCCTGATGG - Intronic
1150762963 17:67979060-67979082 GCTGCTTCAGAGGCTGAGGTGGG + Intronic
1151509479 17:74549528-74549550 GCTGCTGAACAGGGAGCTGTGGG + Intergenic
1152629804 17:81405813-81405835 GCTGCCTCACAGGATCCAGAGGG - Intronic
1156741358 18:40332978-40333000 GCTGCTTCATAGGATACATTAGG + Intergenic
1158683262 18:59588802-59588824 GCTGCTTGAGAGGATGCTAGGGG - Intronic
1159393807 18:67830505-67830527 GCTGCTTCACCAGGTGCTGCTGG + Intergenic
1160049811 18:75422166-75422188 GGGCATTCACAGGATGCTGTGGG + Intronic
1160742416 19:693337-693359 GCTACTTGAAAGGCTGCTGTGGG - Intronic
1161199195 19:3005218-3005240 GCTGATTCATAGGAAGCTGTGGG - Intronic
1161966700 19:7552963-7552985 GGTGCTGCACAGGAGGCTGGTGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1165821113 19:38676715-38676737 GCTGCTTCAGGAGAAGCTGTGGG - Intronic
1166078990 19:40431664-40431686 GCTGCTTCAGAGGCTGAGGTGGG + Intergenic
1167212838 19:48144237-48144259 GCTGCTTCACAGGGTGGTCAGGG + Intronic
1167237133 19:48321905-48321927 GCTGCTTCCCGGGAAGCCGTTGG - Intronic
1168646324 19:58061266-58061288 GCTGCTTAACAGGCTGAGGTGGG - Intronic
925247965 2:2401566-2401588 GCTGATCCACAGGATGCTGTAGG + Intergenic
925694886 2:6566258-6566280 GCTGTTTCACATGATGTTGGAGG - Intergenic
927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG + Intronic
927497662 2:23561663-23561685 GCCGCCTCACAGGCTACTGTAGG + Intronic
927497829 2:23562553-23562575 GCTGCCCCACAGGAGCCTGTGGG - Intronic
928903374 2:36344925-36344947 GCTGATACACAGGATGGTGGAGG + Intergenic
929650310 2:43673462-43673484 ACTACTTTACAGGATGTTGTAGG - Intronic
931422457 2:62141005-62141027 GTTGATTCACAGGATGCAGGTGG + Intronic
931732839 2:65168245-65168267 GCTGCTTGAAAGGCTGCAGTGGG - Intergenic
934187862 2:89762826-89762848 GCTGCCACACAGGGTGCTGCTGG - Intergenic
934975059 2:98796249-98796271 CTTGCTTCACAGGCTCCTGTTGG + Exonic
935223594 2:101035232-101035254 GCTGCTCCTCAGGGTGCTGTGGG - Intronic
935534196 2:104274021-104274043 GGTGATTCCCAGGATGCTGGTGG + Intergenic
935940102 2:108229110-108229132 GCTTCTTCCCAGGAGGCTGATGG + Intergenic
936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG + Intergenic
938035987 2:128035389-128035411 GCTACTGCAGAGGATGATGTGGG - Intergenic
942127360 2:172840716-172840738 GCAGCTTCACTTGATGCTTTTGG - Intronic
944321173 2:198344627-198344649 ACTGCTTCACAGTATGATTTAGG + Intronic
944539749 2:200743947-200743969 GCCTCTGCACGGGATGCTGTGGG - Intergenic
945218857 2:207464203-207464225 GCTGCTTCTCCGAATGCTCTCGG - Intergenic
945240927 2:207676245-207676267 CATGCTTCACAGGATGTTGCTGG + Intergenic
946367918 2:219261681-219261703 GCTGGTTCAGAGGCTGCTGAAGG - Intronic
947363742 2:229372729-229372751 GCTGGTTCAGAGGCTCCTGTAGG + Intronic
947461198 2:230306235-230306257 GCAGGTTCCCAGGATGCAGTGGG - Intronic
948638729 2:239359731-239359753 GCTTCCTCCCAGGAGGCTGTGGG - Intronic
1171117549 20:22538472-22538494 GCTGCTCCACAGGCTGAGGTGGG - Intergenic
1172984225 20:38969964-38969986 CCTGCTCCACAGGATGCCCTTGG + Intronic
1173833963 20:46113057-46113079 GCTGCTACCCAGGACGGTGTGGG + Intergenic
1175185104 20:57174630-57174652 GCTGCTTCTCAAGATGATGCCGG - Intronic
1175338043 20:58209215-58209237 GCTGCTGCATTGAATGCTGTAGG - Intergenic
1180535835 22:16392208-16392230 GCTGCCACACAGGGTGCTGCTGG + Intergenic
1181085475 22:20437640-20437662 GCTGCTGCTCTGGATGCTGCCGG - Exonic
1181090233 22:20467484-20467506 GCTCCATTTCAGGATGCTGTGGG + Intronic
1181573978 22:23782462-23782484 GCTGCCTTCCAGGATGCTGATGG + Exonic
1183040598 22:35174967-35174989 GCTGCTGCACAGCATGGTGAGGG - Intergenic
1183202613 22:36396250-36396272 GCTTCAGCACAGGGTGCTGTTGG + Intergenic
1183415334 22:37678560-37678582 GCTGTTGCACACGATGGTGTTGG - Exonic
1183584439 22:38744467-38744489 GCTACTTCACAGGCTGATGCAGG + Intronic
1184121209 22:42451719-42451741 TCTGCTTCAGGGGATGGTGTGGG - Intergenic
949949347 3:9216417-9216439 GCTGCTCCACAGGGTGTTTTGGG - Intronic
950277966 3:11680097-11680119 GCAACTGCACAGGATACTGTGGG - Intronic
950659264 3:14456685-14456707 GCTCCTGCCCAGGATGCTCTTGG - Intronic
954108385 3:48421167-48421189 CCTGCTTCAGGGGATGCGGTGGG - Intronic
954527382 3:51284031-51284053 TCTGCTTCTCAGGCTGCTGGTGG - Intronic
956847859 3:73200145-73200167 GCTGCTTGACTTGATGGTGTCGG + Intergenic
959567364 3:107846337-107846359 CCTGCTTCCCAGGATCATGTTGG - Intergenic
961238461 3:125389174-125389196 GCTGCTTGAGAGGATGAGGTGGG + Intergenic
961509875 3:127394211-127394233 CCTGCTTCCCAGGTTGTTGTGGG - Intergenic
962382415 3:134908642-134908664 GCTGCTTAACAGGGTGCTTCTGG - Intronic
962946044 3:140172052-140172074 CCTACCTCACAGGATGCTGTGGG + Intronic
963848133 3:150180957-150180979 GCGGCTTCACAGAATGGTATCGG - Intergenic
964206053 3:154176551-154176573 GCTGCTTCACAGGATGTAGATGG + Intronic
969401364 4:6957789-6957811 GCTGCTTCAGAGGCTGAGGTGGG + Intronic
969960202 4:10937417-10937439 GCTTCTTCACAGGCTGGTGAGGG - Intergenic
970890520 4:21038888-21038910 GCTCCTTCACAGTGTTCTGTTGG + Intronic
974555463 4:63441270-63441292 CCTTCTTCACAGGATCCTGAAGG + Intergenic
974700287 4:65434764-65434786 GCTGCTTCACATAATGTTGTAGG + Intronic
975818491 4:78244815-78244837 GCTGCTTCACTGGCTGCACTAGG + Intronic
977120340 4:93091869-93091891 GCTGCCACACAGGCTGCTCTGGG + Intronic
980338427 4:131506709-131506731 TCTGCTACACAGAATGCTATAGG - Intergenic
980578720 4:134720103-134720125 GCTACTGCACTGAATGCTGTGGG - Intergenic
982128627 4:152206557-152206579 GCTGCTCCTCAGCATGCTGATGG - Intergenic
983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG + Intergenic
983713367 4:170747782-170747804 GCTACTCCATAGGATGCTATAGG + Intergenic
984104017 4:175521742-175521764 GCTGCTTCAGAGTCTGCCGTTGG - Intergenic
986280644 5:6319338-6319360 GCTGCATCACCGGATGTTGGCGG + Intergenic
987954309 5:24717963-24717985 GCTGCTCCACAGGGAGCTTTTGG + Intergenic
990013927 5:51034635-51034657 GCTGCTTTATTGTATGCTGTAGG + Intergenic
992581788 5:78185554-78185576 GCTTCTTTAGTGGATGCTGTAGG - Intronic
992734570 5:79705862-79705884 CCTGCTTCACAGGTACCTGTGGG + Intronic
993065782 5:83095795-83095817 GCCCCTTCACAGTCTGCTGTGGG + Intronic
996433486 5:123406982-123407004 ACTGCTTCACAGGTTGTTTTAGG - Intronic
997675697 5:135711467-135711489 GCTGCTTCACAAGTTGCTTTTGG + Intergenic
997754300 5:136381388-136381410 CCTGCTTTACTGGATGCTGCTGG - Intronic
999727368 5:154447282-154447304 GCTGCTTCGCAGGCAGCTGTGGG + Intronic
1000436145 5:161211771-161211793 GCTGCTTTATTGGATTCTGTAGG - Intergenic
1001454436 5:171849808-171849830 GCTGCCTCTCAGGATGCTGGTGG + Intergenic
1003500601 6:6699880-6699902 GCTGGTTCACAGGAGGTTGGTGG + Intergenic
1004179545 6:13369140-13369162 GATGCACCACAGGGTGCTGTGGG - Intronic
1004572913 6:16865256-16865278 TCTGCATCAAAGGTTGCTGTGGG + Intergenic
1005637401 6:27765214-27765236 ACTGCAGCCCAGGATGCTGTGGG + Intergenic
1006575547 6:35042749-35042771 CCTGCTTCGCAGGACGGTGTGGG - Intronic
1006831568 6:36971194-36971216 GCCGCTCCACAGGAAGCTGAGGG - Intronic
1007248589 6:40480388-40480410 GCTGCTTCAGAGGCTGAGGTGGG - Intronic
1010454681 6:76041255-76041277 ACTGCTTCACAGGATTCTGATGG - Intronic
1011898928 6:92268116-92268138 TCTGCTTCTCAGGATTCTGTAGG + Intergenic
1013101036 6:106986984-106987006 GCTGCTTGACAGGCTGATGTAGG + Intergenic
1013315916 6:108942995-108943017 GGAGCTTCACAGGAAGCTGCCGG + Intronic
1013364637 6:109427493-109427515 GCTACTTCAGAGGCTGCGGTGGG - Intronic
1015487637 6:133790292-133790314 GCTGTTTCACAGGCTGCTGTTGG + Intergenic
1016240741 6:141926997-141927019 GGTGCTTTGCAAGATGCTGTGGG - Intergenic
1017288443 6:152705984-152706006 GCTGCTTTATCGGATGCTGCTGG + Intronic
1017552159 6:155520593-155520615 GCTGCTTCTCATGAAGCTGAGGG - Intergenic
1018172205 6:161152115-161152137 GCTGCCTGCCAGGATGTTGTGGG + Intronic
1018231968 6:161683628-161683650 GCTGCTTGGCAGGGTGGTGTGGG + Intronic
1020682063 7:11249306-11249328 CCTTCTGCTCAGGATGCTGTAGG + Intergenic
1021715472 7:23458132-23458154 GATGCTTCATAGGATCCTGTTGG - Intronic
1022382840 7:29876051-29876073 GCTGCTTCCCAGGATGCATATGG + Intronic
1022752095 7:33239895-33239917 GCTGCTTCAGAGGCTGAGGTAGG + Intronic
1023843212 7:44108002-44108024 GAGGCTTCACAGGAGGCTCTGGG - Exonic
1024226461 7:47329630-47329652 GCTCCTGCAAATGATGCTGTCGG + Intronic
1024722380 7:52151835-52151857 GATGCTTCCCAGCAGGCTGTGGG - Intergenic
1024855554 7:53774304-53774326 GCTGTTACACAGGCTGCTGGAGG + Intergenic
1027203951 7:76082173-76082195 GCTACTTGAGAGGCTGCTGTGGG + Intergenic
1028420440 7:90626826-90626848 GCTGCTCCACAGGTTGAGGTGGG + Intronic
1029212126 7:98917707-98917729 GCTGCTTCCCTGGAAGCAGTGGG + Intronic
1029306899 7:99626227-99626249 GCTGGTTCCCAGGATGGTGAGGG + Intronic
1029736443 7:102468256-102468278 CCAGCTTCACAGCAGGCTGTGGG - Exonic
1034996443 7:155580225-155580247 GCTGATTCCCAGGATGGTGAGGG + Intergenic
1035850097 8:2910471-2910493 GCTCACACACAGGATGCTGTGGG + Intergenic
1036283350 8:7420415-7420437 ACTGCTTCATTGGATGCTGCTGG + Intergenic
1037094378 8:14965967-14965989 GCTGCTTGAGAGCATTCTGTAGG - Intronic
1038674680 8:29612951-29612973 GCTTCTCCACAGGATGATGTGGG - Intergenic
1039329694 8:36523646-36523668 GCTGCTTCACAGGTTGCCAGAGG + Intergenic
1039476571 8:37842018-37842040 GCTGCTGCCCAGGTAGCTGTCGG - Exonic
1040619761 8:49078437-49078459 GCTGAAACACAGGAAGCTGTGGG - Intergenic
1041334969 8:56771965-56771987 ACTGGGTCACAGGATGCAGTCGG + Intergenic
1044009743 8:86979477-86979499 GCTACTTCACAGGCTGAGGTGGG + Intronic
1044327149 8:90871709-90871731 TCTGGTTCATGGGATGCTGTAGG - Intronic
1044828407 8:96220793-96220815 GCTCCTTCACAGGAAGCAGGAGG - Intergenic
1045477975 8:102569329-102569351 GCTGCTTCACAGGAGGAGCTGGG + Intergenic
1047537010 8:125729197-125729219 GGTGTTTCACAGAAGGCTGTAGG - Intergenic
1049308899 8:141923004-141923026 GCTGTTTGACACGATGCTTTAGG + Intergenic
1049309974 8:141928626-141928648 CTTGATTCAAAGGATGCTGTTGG - Intergenic
1049681681 8:143921513-143921535 GCTGCACCACAAGCTGCTGTCGG - Exonic
1049785513 8:144448852-144448874 GCTGTTTCTGAGAATGCTGTGGG - Intergenic
1049935036 9:493455-493477 GCTGCTTCACTGGATGGTTCTGG - Intronic
1051377380 9:16416703-16416725 CCTCCTTCAGAGGATGCTATGGG - Exonic
1051595542 9:18821321-18821343 GCAGGGTCACAGGATGCTGGTGG + Intronic
1054712281 9:68523309-68523331 ACAGCTTCCCAGGATGCTGTTGG - Intronic
1055171617 9:73266027-73266049 GCTCCTTCAGAGGATGCAGGTGG + Intergenic
1055194428 9:73570518-73570540 GCTGCATAACAGGCTCCTGTTGG - Intergenic
1055603954 9:77948843-77948865 GATGCTTCACACGGAGCTGTTGG - Intronic
1056778727 9:89533463-89533485 GCTGCTTCCCACGAGGCTGGTGG + Intergenic
1058506252 9:105669132-105669154 GCTGATACACAGGAAGCTGTTGG - Intergenic
1058570255 9:106334325-106334347 GCTACTTCACAGGATTCTCTTGG - Intergenic
1060868541 9:127020307-127020329 CCTGCTTCACAGGAAGGTGCAGG - Intronic
1061929771 9:133826511-133826533 GCAACCTCACAGGCTGCTGTGGG - Intronic
1062036836 9:134386224-134386246 GCTGCATCACCCGAGGCTGTGGG + Intronic
1187527112 X:20064233-20064255 TGTTCTTCACAGGATGCTGAGGG - Intronic
1187716358 X:22106403-22106425 GATGCTTCACAGAAATCTGTGGG - Intronic
1190949930 X:55133460-55133482 CCTGCCTCACAGGATGATATTGG + Intronic
1191085732 X:56565016-56565038 GCTGATTCAGAATATGCTGTCGG + Exonic
1191882419 X:65856399-65856421 GCCGCTTCACAGTTTGATGTTGG + Intergenic
1192541462 X:71976625-71976647 GCTGCCTCACAGGTTACTGCGGG - Intergenic
1196418962 X:115503621-115503643 GCTGCTTAAGAGGATGAGGTGGG + Intergenic
1196474194 X:116063844-116063866 ACTGTTTCACAGGTTGCTCTTGG + Intergenic
1198485802 X:137086499-137086521 GCTTTTTCATAAGATGCTGTGGG - Intergenic
1200111994 X:153745086-153745108 GCTGCCACACAGGGTGCTGCTGG + Intergenic