ID: 927209761

View in Genome Browser
Species Human (GRCh38)
Location 2:20631861-20631883
Sequence CTGAATACACAAAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 7, 2: 24, 3: 94, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927209752_927209761 -5 Left 927209752 2:20631843-20631865 CCCAGTACCCCCAAGAGCCTGAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG 0: 1
1: 7
2: 24
3: 94
4: 351
927209753_927209761 -6 Left 927209753 2:20631844-20631866 CCAGTACCCCCAAGAGCCTGAAT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG 0: 1
1: 7
2: 24
3: 94
4: 351
927209751_927209761 15 Left 927209751 2:20631823-20631845 CCTACATTCTACAGCAAGCGCCC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG 0: 1
1: 7
2: 24
3: 94
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927209761 Original CRISPR CTGAATACACAAAGGGACAA TGG Intronic
900901006 1:5515818-5515840 GTGAAGACACAAAGGAACAGAGG - Intergenic
901361154 1:8702169-8702191 CTTAAAACACAGAGGCACAAAGG + Intronic
901419310 1:9139707-9139729 TTGGATACACCAAGGGACACGGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903249930 1:22045496-22045518 CTGAATCCACAGAGGCACAGAGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
903986524 1:27233292-27233314 CTGAATACTCCCAGAGACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904588787 1:31595859-31595881 CTGAATACAGAATGGGAAAGTGG - Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
906172000 1:43734133-43734155 CTGAGTAAATAAAGAGACAAAGG - Intronic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
908550906 1:65207736-65207758 TTGAATACACATGGGCACAAAGG - Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
908790823 1:67779524-67779546 CAGAATCCACAAAGGCATAAGGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909584971 1:77279927-77279949 CCAAATAAACAAAGGGCCAAGGG + Intergenic
910244918 1:85128298-85128320 CTGAACACAGAAAGGGCTAAAGG - Intronic
910914326 1:92273211-92273233 CAGAATACAAAAAGGAACCATGG + Intronic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
912372958 1:109187797-109187819 CAGAACACAGAAAGGCACAAGGG - Intronic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915921742 1:159980968-159980990 CTGCATACACTAAGGGACCAGGG + Intergenic
916240014 1:162630351-162630373 CTGAACACAGAAAGGACCAAGGG - Intergenic
916425272 1:164674315-164674337 CTGAAAACACAAAGACACTATGG - Intronic
916701121 1:167296143-167296165 CTGAATGCAAAAAGGCTCAATGG - Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918366169 1:183810141-183810163 ATGAATACTCAAAGGGACAGAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919605799 1:199681909-199681931 TTAAAAACAAAAAGGGACAAAGG + Intergenic
919716436 1:200782436-200782458 CTGACTGCAAAAAGGCACAAGGG - Intronic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1065047853 10:21759862-21759884 CAGAGTAGAGAAAGGGACAAAGG - Intronic
1065131763 10:22628892-22628914 CTGAATTCCAAAAGGGAAAATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074658816 10:115627082-115627104 GTGAATACACAAAGTGACACCGG - Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1077936899 11:6797687-6797709 TTGTGTACACAAAGGGACTATGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078960617 11:16264029-16264051 ATGATTACACACAGAGACAAAGG - Intronic
1080319953 11:30996578-30996600 CAGAATACAGAAAGGGCAAAAGG - Intronic
1080714055 11:34781142-34781164 CTGAATACACATAGACATAAAGG - Intergenic
1080722403 11:34862686-34862708 ATGAACACACAATGGGCCAAAGG + Intronic
1080845051 11:36019736-36019758 CTGGATACAGAAAGAAACAAAGG + Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081102922 11:39027568-39027590 CTAAATACAGAAAGGTACAGTGG - Intergenic
1081170531 11:39864565-39864587 CTAAATAACCAAAGGGTCAAAGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082257625 11:50049962-50049984 CTGAATACACATGGCCACAAAGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083177499 11:60960401-60960423 GTGAATACCCAAAGAGACGAGGG + Intergenic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1088333713 11:108679838-108679860 CTTAATAAACGAAGGGAGAAGGG + Intronic
1088599002 11:111459451-111459473 CTGAATTCAGAAAGGAAGAAAGG - Intergenic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1092611003 12:10173324-10173346 AAGAATACACAAAGGAAGAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097562102 12:61220321-61220343 CTTACTACACAGAGGAACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1099135672 12:78896804-78896826 ATGAATACAAAAAGAGAAAAAGG + Intronic
1099890802 12:88586384-88586406 CTGCATCCACAAAGCTACAAGGG - Intergenic
1100409891 12:94305456-94305478 CGGTATACACACAGGCACAAGGG - Exonic
1101111625 12:101492125-101492147 CTCCACACACAAAGGGACACAGG - Intergenic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106365697 13:29077912-29077934 ATCAATACAAAAAGGGAAAATGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108064786 13:46565955-46565977 CTGAATACACAACGTGGCACAGG - Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1109638531 13:65154869-65154891 GTCAATTCACAAAGAGACAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1112796226 13:103059495-103059517 CTGAATACACTCAGGCACATAGG - Intronic
1112944351 13:104908514-104908536 CTGAATAACCAATGGGTCAATGG - Intergenic
1112989460 13:105494586-105494608 CATAATACACAAAGGGACACAGG - Intergenic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1115379490 14:32719180-32719202 GTGAATACATAAAGGTATAATGG + Intronic
1116031190 14:39574542-39574564 CAAACTACACAAAGAGACAAAGG - Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116787289 14:49301609-49301631 CTGAAAACACAGAGGGACTCAGG + Intergenic
1117056791 14:51920257-51920279 CTGAAGATATCAAGGGACAACGG + Intronic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1118395130 14:65329754-65329776 CTGAATACTCAAAGAGAGGAAGG + Intergenic
1118680822 14:68239790-68239812 ATGTATACTTAAAGGGACAATGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122783099 14:104151992-104152014 CTGAGGACAGCAAGGGACAAAGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1128455442 15:67829000-67829022 CTGAATCTACAAGGGGGCAAGGG + Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133455209 16:5935877-5935899 CTGAATTCACAGAGGTATAATGG + Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1134811767 16:17173575-17173597 CTCAATGCACACAGGGACAAAGG + Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137061790 16:35797406-35797428 ATGAGTACACAAAGGCACACGGG - Intergenic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1138600472 16:58051246-58051268 CTGAATTCCAAAAGGGAAAAGGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141301615 16:82821410-82821432 CTGAATTCACCAAGGGGCATAGG - Intronic
1141384599 16:83608292-83608314 CAGTTTTCACAAAGGGACAAAGG + Intronic
1142221706 16:88858082-88858104 CTGAACACACACAGGGTAAATGG + Intronic
1143033771 17:3982718-3982740 CAGTAAACACAAAGGGCCAAGGG - Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144655522 17:17032904-17032926 GTGCATACACACAGGGACACAGG - Intergenic
1147032544 17:37651510-37651532 TGGAAGAGACAAAGGGACAAGGG + Intergenic
1147441973 17:40452975-40452997 CTGAATACAGACAAGGACGAGGG + Exonic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155736184 18:29225148-29225170 CTGGATACACAAGGGAAAAAAGG - Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1156088468 18:33438026-33438048 CTGAAAATATAAAGGGACTATGG + Intronic
1156701804 18:39834955-39834977 ATGAAGACACAAAGACACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1157476834 18:48029146-48029168 TTAAAAACACAAAGGGAAAATGG - Exonic
1158148251 18:54340974-54340996 CCAAATACATAAAGGGAAAATGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1168363462 19:55763246-55763268 CTAGATACACATAGGTACAAAGG + Intergenic
1168364419 19:55773250-55773272 CTAGATACACATAGGTACAAAGG + Intergenic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925853188 2:8104180-8104202 CTGAAAACACAAACAGGCAACGG + Intergenic
926221127 2:10936162-10936184 GTGAATGCACAAAGAAACAAGGG + Intergenic
926429023 2:12767163-12767185 GTTATTACACAGAGGGACAAGGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
930273614 2:49285158-49285180 CAGAATACATAAAGGAAAAATGG + Intergenic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935730588 2:106062109-106062131 CTGAATGCACACAGGGGAAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
943179825 2:184528159-184528181 CTGGAAACAGAAAGGAACAAAGG - Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
945246357 2:207720759-207720781 AGAAATACACAAAGGGAGAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172189561 20:33053839-33053861 CTGAGGACACAAAGGGGCCACGG - Intergenic
1172574229 20:35995015-35995037 CTGAACACAGCAAGGGACATAGG - Intronic
1173709147 20:45139233-45139255 CTGGATACACACTGGGACGAGGG - Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174400040 20:50271047-50271069 CTGAATACAAAAAAGATCAAGGG + Intergenic
1174591966 20:51653150-51653172 CTGAAGACACCAAAGGCCAAAGG + Intronic
1175452552 20:59082103-59082125 AAGAATACATAAACGGACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178018731 21:28384073-28384095 CTGAATACAAAAGAGGAGAAGGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178839497 21:36127489-36127511 TGGTAAACACAAAGGGACAATGG + Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181286708 22:21757682-21757704 CTGAGTACAGGAAGCGACAATGG + Exonic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182559872 22:31151293-31151315 ATGAACACTTAAAGGGACAAAGG - Intergenic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184602365 22:45551222-45551244 CTGAATACAATTAGGGGCAAGGG - Intronic
1184806414 22:46797352-46797374 CAGCATTCACAAAGGGACAGTGG + Intronic
949332977 3:2942861-2942883 CAGAATACATCAAGGGACTAGGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953488271 3:43323936-43323958 ATGACTACACAGAGGCACAAAGG + Intronic
953575461 3:44109849-44109871 CTGAATACGCTAAGTGAAAAGGG - Intergenic
954355348 3:50080291-50080313 GGGAACACACACAGGGACAAGGG - Intronic
954521164 3:51227972-51227994 CTGATTACAGCAAAGGACAAAGG + Exonic
954861897 3:53697165-53697187 CTGAACACAATAAGGGAAAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956121804 3:65973837-65973859 CTGAAAACAAAAAGGTACTAAGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957167127 3:76689814-76689836 CTGACTACACACAGAGAGAACGG - Intronic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
959538977 3:107519209-107519231 GTGAAAACAAAAAGGGAAAAGGG + Intergenic
960022663 3:112972790-112972812 GTAAATTCACAAAGGAACAAGGG - Intronic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960675465 3:120190328-120190350 CTGATTTAACAAAGGCACAAAGG + Intronic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962124747 3:132605061-132605083 CTGACTACACAAGGAGAGAATGG + Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962390300 3:134966069-134966091 CTGGGTACACAGAGGGGCAAGGG + Intronic
962973941 3:140429839-140429861 CTCCATAGGCAAAGGGACAAAGG + Intronic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967704040 3:192629681-192629703 ATGAATACAAAAAAGTACAAAGG + Intronic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972055960 4:34804134-34804156 CTGAATACCAAAAGGAACTAAGG - Intergenic
972635017 4:40876529-40876551 CTGCAGACACCAAGCGACAACGG - Intronic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972956768 4:44402079-44402101 CTGAATTCACAAAGGTAAAGTGG + Intronic
973128746 4:46622321-46622343 CTGAACACACAAAAATACAAAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
977216554 4:94291903-94291925 TTGCATACACAATGGGATAATGG + Intergenic
979022196 4:115517151-115517173 CTTAATACATAAAGAGGCAAAGG - Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
981061197 4:140427280-140427302 CTGAAGACACAAAGGGTCCCAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982748788 4:159134112-159134134 CTGCCTACAAAAAGGCACAAAGG - Intronic
983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG + Intergenic
984264997 4:177487739-177487761 CTGAACCGACAAAGGAACAAGGG - Intergenic
984429675 4:179632632-179632654 CAGAATACACAATGGGAAATAGG - Intergenic
984546372 4:181109042-181109064 CCAAATACACATAGGGAAAAGGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990955521 5:61334465-61334487 CTGACTACAGAAAGAGAAAAAGG - Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
995594347 5:113731725-113731747 CTGAATTCTAAAAGGGAGAAGGG + Intergenic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
995825969 5:116299805-116299827 CAGACTACATAAGGGGACAAAGG + Intronic
996647199 5:125830256-125830278 ATGAAAATAGAAAGGGACAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997575122 5:134969474-134969496 CTGAATACCCCAAGAGAAAATGG - Exonic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000063641 5:157677169-157677191 CTAAATACAGAAAGCCACAAAGG - Intronic
1000479795 5:161758020-161758042 TTAAATACACCAAAGGACAATGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003478466 6:6507669-6507691 GTGAAAACACAAAAGGAAAAAGG - Intergenic
1003941831 6:11036422-11036444 CTGAACACAGAAAAGGCCAAAGG + Intronic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004831161 6:19477864-19477886 ATGAATACCCAAAGGTACAGAGG - Intergenic
1005144817 6:22676995-22677017 CTGATTACATACAGGGATAAAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1008193692 6:48492002-48492024 CTGAAAACACAAAGAAACAAGGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010155028 6:72782644-72782666 TAGGAGACACAAAGGGACAAGGG - Intronic
1010931849 6:81813249-81813271 GAGCATACACAAAGGCACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012205797 6:96458911-96458933 CTGAATTCCAAAAGGGACGAGGG + Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014271617 6:119342871-119342893 CTGTATATACAAAGGGTGAAAGG - Intronic
1014297345 6:119636201-119636223 ATGCATACTCAAAGGGACACTGG - Intergenic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016805184 6:148205423-148205445 CTAAATACAAAAAGGGACTTGGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017852791 6:158319779-158319801 CAGAATACACAATGTGAGAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021491137 7:21220944-21220966 CGGAATACACAAAGCAACACGGG - Intergenic
1022047743 7:26636205-26636227 CTGTGTATACCAAGGGACAACGG + Intergenic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1025962897 7:66239352-66239374 GGAAATACGCAAAGGGACAATGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029343912 7:99965122-99965144 ATGAATACCCAAAGCGACATTGG + Intergenic
1029912617 7:104170813-104170835 CTGAAGACAGAAAAGAACAATGG - Intronic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1032375183 7:131407721-131407743 CAGCATACACAAAGGCACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033719184 7:144039011-144039033 TTCAATACAGAAAGGCACAAGGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035460815 7:159037388-159037410 CTGTTCACACAAAGGGACAGAGG - Intronic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037722306 8:21455290-21455312 CTGAACCCACAAAGGGACCTCGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039683741 8:39772592-39772614 CAGAAAACACAAAGGAATAATGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040117538 8:43640803-43640825 TAGAATTCACAAAGGGACATTGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042414351 8:68501866-68501888 CTAGATACACATAGGTACAAAGG + Intronic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042884230 8:73530405-73530427 AAGAACACACAAAGGAACAAAGG + Intronic
1043210270 8:77505233-77505255 GTGGATAAAGAAAGGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044511313 8:93082859-93082881 CAGATTACTCAAAGGGATAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044821636 8:96159542-96159564 CTTAATACACAAAGGTACATGGG - Intronic
1044964603 8:97562871-97562893 CTGAATGCATAAAGGAACCAGGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047819105 8:128499040-128499062 CTGGAGACCAAAAGGGACAATGG + Intergenic
1048635427 8:136290415-136290437 CTGAAAACACCACGGGACTAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1053228980 9:36389310-36389332 TTGAAAACACAAAGGGAGTATGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056408618 9:86301993-86302015 TTAAATTCACAAAGGAACAATGG + Intronic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057905088 9:98976964-98976986 CAGCATACACAAAGGCTCAAGGG + Intronic
1058366024 9:104209395-104209417 CTGAATACACAAAGAGAAGTAGG - Intergenic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060078544 9:120618428-120618450 ATGAATACATAAAGGTACACTGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061794079 9:133074039-133074061 CTGATTCCACAATGGGTCAAAGG + Intronic
1186156949 X:6735492-6735514 GTAAATACACAAAGAGAGAAAGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188882846 X:35511254-35511276 CGGATAATACAAAGGGACAAAGG + Intergenic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194127250 X:90035165-90035187 CTGAATAATCAATGGGTCAAAGG - Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1199009021 X:142737327-142737349 ATGTAGACACAAAGGGACAGAGG + Intergenic
1199279147 X:145979081-145979103 TTGAGTACACAAAGGTACCATGG - Intergenic
1199702564 X:150393757-150393779 CTGATTAAACAATGGGCCAAAGG - Intronic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200671048 Y:6091809-6091831 CTGAATACACAAAAGGTAAGTGG - Intergenic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1202024870 Y:20510940-20510962 CTGTATCCTCAAAGGGCCAATGG - Intergenic