ID: 927210403

View in Genome Browser
Species Human (GRCh38)
Location 2:20635725-20635747
Sequence TGCGGTTGCATGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927210398_927210403 23 Left 927210398 2:20635679-20635701 CCATAGGGTGGAAAAGCAGAGTA 0: 1
1: 0
2: 2
3: 15
4: 177
Right 927210403 2:20635725-20635747 TGCGGTTGCATGGATGCTGCTGG 0: 1
1: 0
2: 0
3: 25
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927210403 Original CRISPR TGCGGTTGCATGGATGCTGC TGG Intronic
901141578 1:7037219-7037241 TGAGATTGCATGAATGCTTCTGG + Intronic
901763066 1:11483068-11483090 GCCGGAGGCATGGATGCTGCGGG + Intronic
904245061 1:29181743-29181765 TGCCGTTGCCGGGATGCCGCGGG - Exonic
904892967 1:33793170-33793192 TGGGGTGGGATGGATGCTACAGG + Intronic
906765529 1:48428026-48428048 TGCAGCAGCATGGATGCAGCTGG - Intronic
909862489 1:80625792-80625814 TGCAGTAACATGGATGCAGCTGG - Intergenic
911036662 1:93557426-93557448 TGCAGTAACATGGATGCAGCTGG - Intergenic
912227070 1:107745989-107746011 TGCATTGTCATGGATGCTGCAGG + Intronic
912659266 1:111513925-111513947 TGCGGTTGCATGGGAGCTGGTGG + Intronic
912802917 1:112732457-112732479 TGTGTGTGCATGTATGCTGCTGG + Intergenic
913684263 1:121216499-121216521 AGCTATTTCATGGATGCTGCTGG + Intronic
914036102 1:144004114-144004136 AGCTATTTCATGGATGCTGCTGG + Intergenic
914153356 1:145063831-145063853 AGCTATTTCATGGATGCTGCTGG - Intronic
914492254 1:148159910-148159932 TGCGGTTGCAGGGAGGCTTGCGG - Intergenic
916017875 1:160766215-160766237 TGCGGGAACATGGATGGTGCTGG - Intergenic
916648412 1:166812207-166812229 TGCAGCAGCATGGATGCAGCTGG + Intergenic
917411054 1:174760471-174760493 TGCAGCAGCATGGATGCAGCTGG - Intronic
918811942 1:189133295-189133317 TGGTGTTTCATGGATGCAGCTGG + Intergenic
920471568 1:206234991-206235013 AGCTATTTCATGGATGCTGCTGG + Intronic
920731642 1:208491654-208491676 TGCAGTAACATGGATGCAGCTGG - Intergenic
923054952 1:230419253-230419275 TGCAGTGACATGGATGCAGCTGG + Intronic
924069965 1:240266508-240266530 TGCAGTAACATGGATGCAGCTGG - Intronic
924860335 1:247914041-247914063 TGCAGCTGCATGGATGCAGCTGG + Intergenic
1062920856 10:1278561-1278583 TGCAGCTACATGGATGCAGCTGG - Intronic
1063966785 10:11352262-11352284 TGTGGTTGCCAGGATGATGCAGG + Intergenic
1066030920 10:31422966-31422988 TGCGGCAGCATGGATGCAGCTGG - Intronic
1067051587 10:43024667-43024689 TGTGAGTGCATGGCTGCTGCTGG + Intergenic
1068356710 10:55919301-55919323 TGCAGTAACATGGATGCAGCTGG - Intergenic
1069890694 10:71650669-71650691 TACCGATGCATGGATGATGCTGG + Intronic
1071512115 10:86268538-86268560 TGTGCTGGCCTGGATGCTGCAGG - Intronic
1071949350 10:90684884-90684906 TGCGTTTGCATGGAGGTTGAGGG - Intergenic
1073018718 10:100423090-100423112 TGCAGTAACATGGATGCAGCTGG - Intergenic
1073019058 10:100425872-100425894 TGCAGTAACATGGATGCAGCTGG + Intergenic
1073943815 10:108729016-108729038 TGTGGTAACATGGATGCAGCTGG + Intergenic
1074892475 10:117747252-117747274 TGCTGGTGTATGGATGGTGCTGG - Intergenic
1075363076 10:121857404-121857426 TGCAGCAGCATGGATGCAGCTGG - Intronic
1075897398 10:126008943-126008965 TGGGGTTGCAGGGGGGCTGCTGG + Intronic
1077757536 11:5049700-5049722 TGCGGCAACATGGATGCAGCTGG - Intergenic
1080111034 11:28568281-28568303 TGCAGTAACATGGATGCAGCAGG + Intergenic
1082247421 11:49940937-49940959 TGCGGGGACATGGATGCAGCTGG - Intergenic
1083264540 11:61540589-61540611 TGCTGTTGCATGCATGATGCTGG + Intronic
1083706091 11:64517379-64517401 TGATGTTGCAAGGATGTTGCAGG + Intergenic
1084841430 11:71854113-71854135 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1087159192 11:94932647-94932669 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1087815207 11:102650619-102650641 TGCAGTGCCATGGATGCAGCTGG - Intergenic
1087918532 11:103838283-103838305 TGCGGCTGCATGGATGGATCTGG + Intergenic
1089012910 11:115145259-115145281 GGCAGTGGCATGGATGCTACAGG - Intergenic
1090864962 11:130691564-130691586 TGCAGCAGCATGGATGCAGCTGG - Intronic
1091186424 11:133651681-133651703 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1092483091 12:8878344-8878366 TGCAGCAGCATGGATGCAGCTGG + Intronic
1092660662 12:10734668-10734690 TGTGAATGCTTGGATGCTGCTGG + Intergenic
1093717029 12:22394253-22394275 TGCAGTAACATGGATGCAGCTGG - Intronic
1094280907 12:28736790-28736812 TGCGGGGACATGGATGATGCTGG - Intergenic
1095780830 12:46057275-46057297 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1097375329 12:58836344-58836366 TGCAGTGACATGGATGATGCTGG - Intergenic
1097980163 12:65729675-65729697 TGCGGGTGGGTGGAGGCTGCAGG - Intergenic
1099698190 12:86048155-86048177 TGCAGCAACATGGATGCTGCTGG + Intronic
1104489841 12:129184204-129184226 TCCGCCTGCATGGCTGCTGCGGG - Intronic
1104615656 12:130266407-130266429 TGCGGCAACATGGATGCAGCTGG + Intergenic
1104731687 12:131108771-131108793 TGCCTTCGCATGGATGCTGGTGG + Exonic
1105807879 13:23968024-23968046 TGCGGGTACATGGATGAAGCTGG - Intergenic
1105861368 13:24418183-24418205 TGCAGTATCATGGATGCAGCTGG - Intergenic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1109175969 13:59156132-59156154 TGCGGTGACATGGATGAAGCTGG + Intergenic
1109652400 13:65346570-65346592 TGCGGCAACATGGATGCAGCTGG + Intergenic
1110488944 13:76079881-76079903 TGCAGTGGCATGGATGATGCTGG + Intergenic
1111039942 13:82734714-82734736 TGCAGCAACATGGATGCTGCTGG - Intergenic
1111457338 13:88502276-88502298 TGCAGGTGCATGGATGGAGCTGG - Intergenic
1112222854 13:97508759-97508781 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1113366826 13:109684186-109684208 TGTGGCTGCATTGATGCTGCTGG - Intergenic
1113394571 13:109934655-109934677 TGCGGTAACATGGATGGAGCTGG - Intergenic
1114138749 14:19886742-19886764 TGCGGTAACATGGATGAAGCTGG - Intergenic
1115013563 14:28581064-28581086 TGCAGCAACATGGATGCTGCTGG - Intergenic
1118119640 14:62824904-62824926 TGCAGTAACATGGATGCAGCTGG - Intronic
1118565055 14:67130414-67130436 TGCAGCTACATGGATGCAGCTGG - Intronic
1119588281 14:75859278-75859300 GGAGGTTGCAGGTATGCTGCAGG + Intronic
1121979430 14:98441823-98441845 CGCAGTTTCATGGATGCTGGCGG + Intergenic
1128250198 15:66158569-66158591 TGGGGTTGCATGGAGGATCCAGG + Intronic
1130069594 15:80635308-80635330 TGAGGTTGCATTGCTCCTGCTGG + Intergenic
1131704669 15:94980223-94980245 TGCAGGAGCATGGATGCAGCTGG + Intergenic
1135778624 16:25279199-25279221 TGCGGCAACATGGATACTGCTGG + Intergenic
1135788059 16:25368215-25368237 TGCAGTAACATGGATGCTGCTGG - Intergenic
1136600784 16:31286144-31286166 TGCGGCAACATGGATGCAGCTGG - Intronic
1137912296 16:52390279-52390301 TGCGGTGGCATGGATGAATCTGG + Intergenic
1138227530 16:55310319-55310341 TGGGGTTGGGTGGGTGCTGCTGG + Intergenic
1138788029 16:59869355-59869377 TGCAGTAACATGGATGCTGCTGG + Intergenic
1138906276 16:61338930-61338952 TGCGGGAGCATGGATGCAGCTGG + Intergenic
1140609829 16:76584563-76584585 TGCAGCTGCATGGATGCAGCTGG - Intronic
1141080977 16:81052173-81052195 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1142133889 16:88442952-88442974 TGGGGTGCCCTGGATGCTGCCGG - Intergenic
1143723076 17:8827269-8827291 TCCGGCTGCCTGGATGCTGCAGG + Exonic
1147049793 17:37785002-37785024 TGCAGTGGCATGGATGGAGCCGG + Intergenic
1147051556 17:37798928-37798950 TGCAGTGACATGGATGCAGCTGG + Intergenic
1148998737 17:51735238-51735260 TGCAGTAACATGGATGCAGCTGG + Intronic
1149198587 17:54154573-54154595 TGCAGTTACATGGATGAAGCTGG + Intergenic
1151062057 17:71106599-71106621 TGCAGTAACATGGATGCAGCTGG + Intergenic
1151158321 17:72142988-72143010 GGTGGCTGCATGGATGCTGAAGG + Intergenic
1151391378 17:73789216-73789238 TACGGTTTCATGGATGCTGGTGG - Intergenic
1154184146 18:12167018-12167040 TGTGGTGGCATGGATGAAGCTGG - Intergenic
1154381110 18:13850716-13850738 TGCGGTAACATGGATGCAGCTGG + Intergenic
1154401860 18:14046370-14046392 TGCAGCAGCACGGATGCTGCAGG - Intergenic
1155230440 18:23768833-23768855 TGCAGCAGCATGGATGCAGCTGG + Intronic
1156276027 18:35583206-35583228 TGAGGTGACAGGGATGCTGCTGG - Intronic
1159111292 18:64059210-64059232 TGCGGTAACATGGATGCAGCTGG - Intergenic
1159632880 18:70769168-70769190 TGCGGGGGCATGGATGAAGCTGG + Intergenic
1160997052 19:1887479-1887501 TGCGGTTGCCTGCAGGCTGGAGG - Intergenic
1161847653 19:6720832-6720854 TGCAGCTGCATTCATGCTGCTGG - Intronic
1163774980 19:19212496-19212518 TGCGGTTGAATGGAGGATTCCGG + Intronic
1164661475 19:29974884-29974906 TGCAGTAACATGGATGCAGCAGG - Intronic
1164912475 19:32024089-32024111 TGCAGCAACATGGATGCTGCTGG - Intergenic
1166381347 19:42356845-42356867 TGCGGCTGCATGGAAGGAGCGGG - Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
925192503 2:1896536-1896558 TGCAGTAACATGGATGGTGCTGG + Intronic
926334802 2:11855092-11855114 TGCATTTGCATAGATGATGCAGG + Intergenic
927070310 2:19522066-19522088 TGCAGTGACATGGATGCAGCTGG + Intergenic
927210403 2:20635725-20635747 TGCGGTTGCATGGATGCTGCTGG + Intronic
927237933 2:20894175-20894197 TGCAGCAGCATGGATGCGGCAGG + Intergenic
927377637 2:22436751-22436773 TGCGGCAACATGGATGCAGCTGG - Intergenic
927414612 2:22865832-22865854 TGGGGGTGCAGGGATGGTGCAGG + Intergenic
928814679 2:35278375-35278397 TGCAGTAACATGGATGCAGCTGG - Intergenic
929103240 2:38338154-38338176 TGCAGCAACATGGATGCTGCTGG + Intronic
929358480 2:41054613-41054635 TGCAGTGACATGGATGCAGCTGG - Intergenic
930275334 2:49304235-49304257 TGCAGGGACATGGATGCTGCTGG + Intergenic
930976351 2:57466651-57466673 TGCAGTAACATGGATGCAGCTGG - Intergenic
932416363 2:71575915-71575937 TGTGGTAGCAAAGATGCTGCTGG + Intronic
932554290 2:72806324-72806346 TGCAGCAGCATGGATGCAGCTGG - Intronic
936439294 2:112536822-112536844 TGCAGTAACATGGATGCTGCTGG - Exonic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941333496 2:164210217-164210239 TGTGATTGCATGGATCCTCCTGG - Intergenic
941639082 2:167968085-167968107 TGCAGTGACATGGATGCAGCTGG - Intronic
941859075 2:170260399-170260421 TGCAGCAGCATGGATGCAGCTGG + Intronic
943147114 2:184059836-184059858 TGCAGTAACATGGATGCAGCTGG - Intergenic
943244846 2:185433611-185433633 TGTGGCAACATGGATGCTGCTGG - Intergenic
945315237 2:208363324-208363346 TGCAGCAACATGGATGCTGCTGG - Intronic
1171098635 20:22359305-22359327 TGCTGCAACATGGATGCTGCTGG + Intergenic
1171392914 20:24812461-24812483 TGGGGTGGCATGGGAGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1173549050 20:43919818-43919840 TGCAGTGGCATGGATGGAGCTGG - Intronic
1175241123 20:57550202-57550224 TCAGGTTGAATGGATGTTGCAGG + Intergenic
1177690524 21:24500422-24500444 TGCAGCAACATGGATGCTGCTGG - Intergenic
1181539520 22:23566005-23566027 TGAGTTTGCCTGGAAGCTGCCGG - Intergenic
1182919413 22:34065564-34065586 AGGGGTTGCAAGGATGCTACTGG + Intergenic
949379238 3:3426500-3426522 TGTGGGTACATGGATGATGCTGG - Intergenic
950708127 3:14796380-14796402 TTAGGTGACATGGATGCTGCTGG + Intergenic
951676773 3:25250250-25250272 TGCTTGTGCATGGATGATGCAGG + Intronic
952293862 3:32043758-32043780 TGCAGCAGCATGGATGCAGCTGG + Intronic
953543722 3:43844581-43844603 TGCAGCAGCATGGATGCGGCTGG - Intergenic
957023610 3:75152939-75152961 TGCAGCAGCATGGATGCAGCTGG - Intergenic
957599924 3:82320889-82320911 TGCAGTAACATGGATGCAGCTGG - Intergenic
957852753 3:85831135-85831157 TGCAGCAGCATGGATGCAGCTGG - Intronic
958265256 3:91430643-91430665 TGCAGCAGCATGGATGCAGCTGG - Intergenic
959754276 3:109878230-109878252 TGCAGTAACATGGATGCAGCTGG + Intergenic
961265727 3:125640804-125640826 TGCCGCAGCATGGATGCAGCTGG + Intergenic
962552996 3:136514758-136514780 TGCAGGGGCATGGATGCAGCTGG + Intronic
962911037 3:139849824-139849846 TGCAGTTACGTGGATGCAGCTGG - Intergenic
963098277 3:141569929-141569951 TGCACTAACATGGATGCTGCTGG - Intronic
963976040 3:151481338-151481360 TGCAGTTGCTTGGACCCTGCGGG - Intergenic
964084191 3:152796770-152796792 TGCAGCAGCATGGATGCAGCTGG - Intergenic
964088704 3:152848123-152848145 TGCAGTAACATGGATGCAGCTGG - Intergenic
965601113 3:170455506-170455528 TGCAGCAGCATGGATGCAGCTGG - Intronic
966242317 3:177768488-177768510 TTAGGTTGCATGCATGCTGCTGG + Intergenic
967879218 3:194287407-194287429 AGAGGTTGCAGGGAGGCTGCAGG - Intergenic
968713687 4:2139006-2139028 TGCGCAGGCATGGAAGCTGCCGG + Intronic
969225478 4:5795030-5795052 TGCAGTAACATGGATGCAGCTGG - Intronic
969782525 4:9420156-9420178 TGCAGCAGCATGGATGCAGCTGG + Intergenic
970425711 4:15944170-15944192 TGCAGTAACATGGATGCAGCTGG - Intergenic
972131803 4:35845977-35845999 TGCAGTAGCATGGATACAGCTGG - Intergenic
972834120 4:42848051-42848073 TGCAGTAACATGGATGCAGCTGG - Intergenic
972983370 4:44732832-44732854 TGCGGCAACATGGATGCAGCTGG + Intergenic
973105026 4:46324863-46324885 TGCAGTAACATGGATGCAGCTGG - Intronic
973651882 4:53004851-53004873 TGAGGTTTCATGGGTGCTGGGGG - Intronic
973864807 4:55101793-55101815 TGCAGCTGCATGGATGGAGCTGG - Intronic
975035760 4:69678469-69678491 TGCAGGTACATGGATGCAGCTGG - Intergenic
975705415 4:77107643-77107665 TGCAGCAGCATGGATGCAGCTGG + Intergenic
977508495 4:97932661-97932683 TGCGGGTGCATGGATGGAGCTGG - Intronic
977686862 4:99856698-99856720 TGCAGTTTCATGTATGCTGATGG + Intronic
978931317 4:114315955-114315977 TGCAGCAGCATGGATGCAGCTGG + Intergenic
980398193 4:132243553-132243575 TCCAGCTGCATGCATGCTGCTGG - Intergenic
981466605 4:145079723-145079745 TGCAGCAGCATGGATGCAGCTGG + Intronic
983956317 4:173702736-173702758 TGCGGCAGCATGGATGCAGCTGG + Intergenic
985570735 5:643472-643494 GGCGGGTGCATGCATGCTGAGGG + Intronic
985872221 5:2565920-2565942 TGCGGTGACATGGATGAAGCTGG + Intergenic
986333308 5:6734166-6734188 TGCGGTTGCAGGGAGGCCGAAGG + Intronic
988173595 5:27691425-27691447 TGCAGCAACATGGATGCTGCTGG + Intergenic
988554783 5:32226639-32226661 TGCGGCAACATGGATGCAGCTGG - Intergenic
989078782 5:37593444-37593466 TGCAGGGGCATGGATGCAGCTGG - Intronic
989499272 5:42147572-42147594 GGAGGTTGGATGGTTGCTGCAGG + Intergenic
990391452 5:55325917-55325939 TGCAGTAACATGGATGCAGCTGG - Intronic
992225891 5:74619439-74619461 TGAGGTTGTGTAGATGCTGCTGG - Intergenic
993892277 5:93488944-93488966 TGCAGTGACATGGATGATGCTGG + Intergenic
994333735 5:98539399-98539421 TGCAGCAGCATGGATGCAGCTGG - Intergenic
994926497 5:106122600-106122622 TGCTGCAGCATGGATGCAGCTGG - Intergenic
995481696 5:112599452-112599474 TGCAGCAGCATGGATGCAGCTGG + Intergenic
995481803 5:112600673-112600695 TGCAGCAGCATGGATGCAGCTGG + Intergenic
997210433 5:132073861-132073883 GGCGGGTGCAGAGATGCTGCAGG - Exonic
998642922 5:144032397-144032419 TGGGGCTCCATGGGTGCTGCCGG + Intergenic
1000822326 5:165999887-165999909 TGCTGCAGCATGGATGCAGCTGG - Intergenic
1001322748 5:170696450-170696472 TGCAGTGGGATGGAAGCTGCAGG + Intronic
1001356984 5:171036734-171036756 TGCAGTAACATGGATGCAGCTGG - Intronic
1001724238 5:173883494-173883516 AGAGGTTGCAGGGAAGCTGCAGG - Intergenic
1002424106 5:179165698-179165720 TGGGGCTGCATGGTAGCTGCAGG + Intronic
1002453021 5:179330454-179330476 GGCAGTTGCAGGGAGGCTGCTGG - Intronic
1004102272 6:12625869-12625891 TGCAGTGACATGGATGCAGCTGG + Intergenic
1004158102 6:13188789-13188811 TGCTGTTGCATGGTTGATGTTGG - Intronic
1006155651 6:32011543-32011565 GGCGGTTCCCTGGATGCTGTCGG + Intergenic
1006161982 6:32044397-32044419 GGCGGTTCCCTGGATGCTGTCGG + Exonic
1006550306 6:34817469-34817491 TACTGTTTCATGGATGCTGGGGG + Intronic
1007100999 6:39246642-39246664 TGCAGTTGCTTGCAGGCTGCAGG - Intergenic
1008172574 6:48227023-48227045 TACAGTGGCATGGATGCAGCTGG - Intergenic
1009007165 6:57801211-57801233 TGCGATAGCATGGATTCTACAGG - Intergenic
1009178697 6:60490553-60490575 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1010348919 6:74848245-74848267 TGCAGCAACATGGATGCTGCTGG + Intergenic
1012354956 6:98302586-98302608 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1014245642 6:119065364-119065386 TGAGGTTGCATTCAAGCTGCTGG - Intronic
1014819260 6:125968308-125968330 TGCAGCAGCATGGATGCAGCTGG - Intronic
1015349808 6:132204411-132204433 TGTGGCAGCATGGATGCAGCTGG - Intergenic
1017981055 6:159401534-159401556 TTCGGTTGCATGAAGGTTGCCGG - Intergenic
1019073318 6:169367312-169367334 TGCAGTCACATGGATGCAGCTGG - Intergenic
1022524530 7:31028663-31028685 TGCAGTCCCATGGATGCTGCGGG - Intergenic
1022961885 7:35435076-35435098 TGCAGCAACATGGATGCTGCTGG + Intergenic
1023522398 7:41061368-41061390 TGCGGTGCCAGGGATGCTGAGGG + Intergenic
1024371226 7:48586425-48586447 TGCAGCAGCATGGATGCAGCTGG + Intronic
1025599802 7:62982006-62982028 TGAGATTGCATGGAGGCTGATGG + Intergenic
1026513328 7:71045627-71045649 TGCAGTAACATGGATGCAGCTGG + Intergenic
1026656674 7:72262649-72262671 TGCAGCAGCATGGATGCAGCTGG - Intronic
1027155140 7:75761846-75761868 TGCAGTAACATGGATGCAGCTGG - Intergenic
1028528364 7:91810594-91810616 TGCAGTAACATGGATGCAGCTGG + Intronic
1029131664 7:98335991-98336013 TGCAGTAGCATGGATGCAGCTGG + Intronic
1029373098 7:100161779-100161801 TGCAGGTGCATGGATGAAGCTGG + Intronic
1030832964 7:114249509-114249531 TGCAGTGGCATGGATGGAGCTGG - Intronic
1031626665 7:124000324-124000346 TGCAGTAACATGGATGCAGCTGG + Intergenic
1033456741 7:141510187-141510209 TGGGCTTACCTGGATGCTGCAGG - Intergenic
1035948076 8:3987333-3987355 TGCAGTTGCAAAGATGCTGTCGG - Intronic
1036613086 8:10366620-10366642 TGCGGGAGCAGGGATGGTGCTGG - Intronic
1036654230 8:10665673-10665695 TTGGGTTGCATCGATCCTGCAGG + Intronic
1037030154 8:14094431-14094453 TGCGGGGACATGGATGATGCTGG - Intronic
1040580349 8:48693828-48693850 TGTGGTGGCATGGGTGCCGCTGG + Intergenic
1043346927 8:79309185-79309207 TGCAGTAACATGGATGCTGCTGG - Intergenic
1046963141 8:120131014-120131036 TGCGGCAACATGGATGCAGCTGG - Intronic
1048233384 8:132665940-132665962 TGCAGTAACATGGATGCAGCTGG + Intronic
1049732881 8:144187825-144187847 TGCTCTTGCAGGGTTGCTGCAGG + Intronic
1050032501 9:1401198-1401220 TGCTGTTGCAGAGATGCTGGAGG - Intergenic
1050836928 9:10093781-10093803 TGCAGTAACATGGATGCAGCTGG + Intronic
1052529718 9:29666330-29666352 TGCAGCTGCATGGATGCAGCTGG + Intergenic
1053264940 9:36705304-36705326 TGCAGTAACATGGATGCAGCTGG - Intergenic
1053535768 9:38923968-38923990 TGCAGCTGCATGGATGCAGCTGG + Intergenic
1053809944 9:41841957-41841979 TGGGGCTGGGTGGATGCTGCTGG - Intergenic
1054207989 9:62148381-62148403 TGCAGCTGCCTGGATGCAGCTGG + Intergenic
1054620649 9:67345471-67345493 TGGGGCTGGGTGGATGCTGCTGG + Intergenic
1054825800 9:69572385-69572407 TGCAGGGGCATGGATGCAGCTGG - Intronic
1055239091 9:74162791-74162813 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1056362048 9:85868209-85868231 TGCAGCAACATGGATGCTGCTGG + Intergenic
1058221061 9:102303213-102303235 TGCGGTAACATGGATGCAGTTGG - Intergenic
1059129819 9:111735107-111735129 TGCAGTGACATGGATGCAGCTGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1062095898 9:134703195-134703217 GGCGGGTGCTTGGATCCTGCTGG + Intronic
1185829352 X:3285027-3285049 TGCGGCTACATGGATGGAGCTGG - Intergenic
1186052007 X:5606434-5606456 TGCAGTGACATGGATGCAGCTGG + Intergenic
1186904982 X:14101210-14101232 TGCAGCAACATGGATGCTGCTGG - Intergenic
1188096627 X:26031613-26031635 TGCGGGAGCATGGATGGAGCTGG + Intergenic
1188526871 X:31096923-31096945 TGCAGCTACATGGATGCAGCTGG + Intergenic
1188724088 X:33560013-33560035 TGCGGCAACATGGATGCAGCTGG - Intergenic
1190531574 X:51384002-51384024 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1192289094 X:69772778-69772800 TGCAGCAGCATGGATGCAGCTGG - Intronic
1192710060 X:73572258-73572280 TGCAGTAACATGGATGCAGCTGG - Intronic
1192881618 X:75290641-75290663 TGCAGTAACATGGATGCAGCTGG + Intronic
1193781479 X:85707757-85707779 TGCGGGTACATGGATGCAACTGG + Intergenic
1194689585 X:96967337-96967359 TGCAGTAACATGGATGCAGCTGG - Intronic
1194753681 X:97712363-97712385 TGCAGTAACATGGATGCAGCTGG + Intergenic
1196052309 X:111318641-111318663 TGCGGTACCATGGATGAAGCTGG + Intronic
1196971002 X:121108560-121108582 TGCAGTAACATGGATGCAGCTGG - Intergenic
1197088154 X:122503826-122503848 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1197993706 X:132348450-132348472 TGCAGTAACATGGATGCAGCTGG + Intergenic
1198735508 X:139780769-139780791 TGCAGTAACATGGATGCAGCTGG + Intronic
1199052557 X:143253768-143253790 TGCAGTTACATGGATGCAGCTGG - Intergenic
1199667094 X:150105504-150105526 TGCAGCTGCTTGGGTGCTGCTGG - Intergenic
1200137822 X:153883507-153883529 TGCAGGGGCAGGGATGCTGCAGG + Intronic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic
1200365121 X:155654619-155654641 TGCAGTTGCATGGATGGAACTGG - Intronic
1201223604 Y:11794315-11794337 TGCGGCAACATGGATGCAGCTGG - Intergenic
1201671636 Y:16528193-16528215 TGCTGTTGCAAGGAGGTTGCAGG - Intergenic