ID: 927210936

View in Genome Browser
Species Human (GRCh38)
Location 2:20638627-20638649
Sequence CCAGATCCCCAGGGGCTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 8, 3: 34, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927210936_927210945 6 Left 927210936 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG 0: 1
1: 0
2: 8
3: 34
4: 350
Right 927210945 2:20638656-20638678 TGGAGGAAGACAGAAAAGAATGG 0: 1
1: 0
2: 20
3: 270
4: 2017
927210936_927210946 12 Left 927210936 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG 0: 1
1: 0
2: 8
3: 34
4: 350
Right 927210946 2:20638662-20638684 AAGACAGAAAAGAATGGACTTGG 0: 1
1: 0
2: 6
3: 88
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927210936 Original CRISPR CCAGATCCCCAGGGGCTGCA GGG (reversed) Exonic
900094797 1:936011-936033 CCTGTCCCCCAGGGGCTGCATGG + Intronic
900130319 1:1084635-1084657 GCAGAGGCCCCGGGGCTGCAGGG + Intronic
900324688 1:2102808-2102830 CCAGAAACCTAGGGGCTGGAGGG + Intronic
900417916 1:2543503-2543525 ACACATTCCCAGGGGCTCCAGGG - Intergenic
900535115 1:3173186-3173208 CCTGAGCCCCGGGGGCAGCAAGG - Intronic
900784011 1:4636393-4636415 GCAGATGCCCAGAGGCTGCCTGG - Intergenic
900990189 1:6095141-6095163 CCAGCTCACCAGGGCCTGCCTGG + Intronic
900992494 1:6104421-6104443 CCAGGCCCCCAGGGGCAGCCCGG + Exonic
901432437 1:9225282-9225304 GCAGTTCCCAAGTGGCTGCAGGG - Intergenic
901841176 1:11955028-11955050 CCAGGTCCCCAGGGGCCACTTGG + Intronic
902661819 1:17909689-17909711 CCAGCTCCCCATTGGCTGCCTGG - Intergenic
903222184 1:21875129-21875151 CCAGATCTCCAGAGGCTGCGAGG + Intronic
903224725 1:21888040-21888062 CCAGTTCCCAAGAGCCTGCACGG - Exonic
903578061 1:24351386-24351408 CCCCCTTCCCAGGGGCTGCAGGG - Intronic
904034377 1:27551045-27551067 GCAGTGCCCCAGGGGCTGCTGGG + Exonic
904266831 1:29323187-29323209 CCAGTTGCCCACAGGCTGCAAGG - Intronic
904428382 1:30446319-30446341 CCTGTTCCCCAGGGGCTTCGGGG + Intergenic
904928539 1:34067507-34067529 CAGGAGCCCCAGGGGCTGCCAGG + Intronic
905036037 1:34918851-34918873 CCAGATCCCCTGGGGCAGGGTGG - Intronic
905387736 1:37615858-37615880 CTAGCTCCACATGGGCTGCAGGG - Intronic
905884813 1:41485893-41485915 CCAGAGCCCCAGAGGAGGCAGGG + Intergenic
906195826 1:43930319-43930341 CAAGGGCCCCAGGGGCAGCAAGG + Exonic
906695550 1:47820997-47821019 ACAGATGCCCAGAGGATGCAAGG - Intronic
907288007 1:53394364-53394386 CCAGACCCTCATGGGCTGGAAGG + Intergenic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
910342784 1:86207388-86207410 CCTCATCCCCAGAAGCTGCAGGG + Intergenic
911088149 1:93996611-93996633 CCAGATCCTCAGGGGTTAAATGG + Intronic
911359835 1:96862784-96862806 CCACATCCCCACTGGCTGCATGG - Intergenic
912413346 1:109492416-109492438 CCAGCTCACCAGGGGCAGCCTGG - Intronic
916127949 1:161588280-161588302 CCATATCCCCTGGGACTGCCTGG - Intronic
916137867 1:161670110-161670132 CCATATCCCCTGGGACTGCCTGG - Intronic
916560500 1:165930755-165930777 ACTGTTCACCAGGGGCTGCAGGG - Intergenic
916963205 1:169909773-169909795 CCAGGTCCCGACGGGCTGCCCGG - Intergenic
917345020 1:174021559-174021581 CTAGATCTCCAGGGACTTCAGGG + Intronic
918142604 1:181732088-181732110 CCAAGTCCCCAGGGCCTGCTGGG - Intronic
920123638 1:203676666-203676688 CCAGATCACCAGGGGGAGCAAGG + Intronic
920183986 1:204149333-204149355 CCAGATCCCCAGGGCACTCAGGG - Intronic
922473199 1:225889046-225889068 GCAGAGCCACAGGGGCTGCATGG + Exonic
922979369 1:229812651-229812673 TCAAATCCCCAGTTGCTGCAGGG + Intergenic
923199567 1:231698342-231698364 CGAGATTTCCAGGGGTTGCATGG + Intronic
924076171 1:240339448-240339470 CTAGATCCCCAGTGGATGCTTGG - Intronic
1062834073 10:624582-624604 CCACATCCAGAGGGGCTGCCCGG - Intronic
1062890537 10:1056674-1056696 CCAGACCCCTCGGGGCTGCGGGG + Intronic
1063972212 10:11389108-11389130 CAAGAGCCCCAAGGACTGCAGGG - Intergenic
1065020767 10:21500318-21500340 CGAGATCCCCAGTGGTTGCGCGG - Intergenic
1065721974 10:28636086-28636108 CCACAGCCCCCGGTGCTGCAAGG - Intergenic
1067286539 10:44911511-44911533 CCAGAACACCTGGAGCTGCATGG - Exonic
1067795566 10:49318954-49318976 CCAGAGCTCCAGGGGATGGATGG - Intronic
1068634990 10:59338811-59338833 CCAGTTCCCCTGGAGCAGCAAGG + Intronic
1071038552 10:81278056-81278078 GCTGATCCCCAGGGGGTGAATGG + Intergenic
1073246019 10:102090687-102090709 CCAGATCTCCCAGGGCTGCTGGG + Intergenic
1073439648 10:103544922-103544944 CCAGAGCCTCAGGGCCTGCCTGG + Intronic
1074162493 10:110845984-110846006 CCAAAGACCCAAGGGCTGCAGGG + Intergenic
1074219264 10:111420406-111420428 ACAGAACACCAGGGGATGCAGGG - Intergenic
1075408247 10:122209006-122209028 CCGGATCCCCATGGGCAGTAGGG + Intronic
1075963318 10:126587893-126587915 CCAGAATTCCTGGGGCTGCATGG - Intronic
1076131753 10:128018336-128018358 CCAGACCCCCAGGGGCTGGATGG + Intronic
1076237004 10:128871290-128871312 CCAGCTCCCCAGCACCTGCAGGG + Intergenic
1076349877 10:129808435-129808457 GCAGAGCCCCGGGTGCTGCATGG - Intergenic
1076381863 10:130028901-130028923 GCAGATGCCCAAGGGCTCCAGGG - Intergenic
1077176255 11:1192320-1192342 CGAGACCCCCAGAGGCTGCCCGG + Intronic
1077233249 11:1468113-1468135 CCAGCTCCACTGGGGCTGAAGGG - Intergenic
1078342066 11:10504723-10504745 ACAGATCCCCAGTGCCTGGAAGG - Intronic
1078453341 11:11456493-11456515 CCAGAGCACCTGGGGTTGCAGGG - Intronic
1081547775 11:44083820-44083842 CCAGGTCCACAGTGGCTGCTGGG - Exonic
1081714262 11:45237446-45237468 CCAGAATCCCTGGGGCTGCCTGG + Intergenic
1081794814 11:45811901-45811923 GCAGATCCCCAGGGGCTGCTGGG + Exonic
1081851710 11:46278699-46278721 CCTGATTCCCTGGGGCTGCCAGG - Intronic
1082851029 11:57764949-57764971 CCAGCTCCCCATGGGCTCTATGG - Intronic
1083306753 11:61765562-61765584 CCTGAAGCCCAGGGTCTGCAGGG + Intronic
1084008302 11:66334597-66334619 CCCGAGCCCCAGGAGCTGCAGGG - Exonic
1084203492 11:67577399-67577421 CCTGATCCCCTGGGGCTGCATGG - Intergenic
1084317505 11:68353978-68354000 CCAGATCCTCAGGGGCCAGAGGG - Intronic
1084474422 11:69380757-69380779 CCAGCTTCCCGGCGGCTGCAGGG + Intergenic
1084604869 11:70166546-70166568 CCACCTCCCCAGTGGCTGCTGGG + Intronic
1085203033 11:74713214-74713236 CCAGATCCCCAGGCAGTGCTGGG - Intronic
1086450143 11:86907539-86907561 CTAGAGCCCAAGAGGCTGCAGGG - Intronic
1088897831 11:114091490-114091512 CCAAAGCCCCAGGGGCTGCTCGG - Intronic
1089104471 11:115990744-115990766 CCAGCTCCCCAGCAGCTGGAAGG - Intergenic
1089309289 11:117547338-117547360 ACAGAACCCCAGTAGCTGCACGG + Intronic
1089362687 11:117901473-117901495 CAAGACCCCCAGGGGATTCATGG - Intronic
1089455307 11:118622297-118622319 CCAGACCCCTGGGGGCTGTAGGG + Intronic
1090226143 11:125073290-125073312 CCAGAGCTCCAGGAGCTTCAGGG + Intronic
1090282565 11:125468788-125468810 GCAGACCCCGAGGGGCAGCATGG + Intronic
1091005501 11:131949646-131949668 CCACATTCCCAGGGTCTCCAAGG + Intronic
1091700347 12:2654890-2654912 CCAGCTCCCACTGGGCTGCAGGG + Intronic
1091887096 12:4024854-4024876 CCAGGTCTCCAGGGGTTTCAGGG - Intergenic
1091897812 12:4119192-4119214 CCAGATACACAGGGGCCTCACGG + Intergenic
1092223378 12:6730602-6730624 CCAGATGAGCAGGGGCTGGAAGG + Intronic
1095981790 12:47978361-47978383 CCAGGTCCCCAGGGTCTGGCTGG - Exonic
1096102582 12:48978640-48978662 CCAGAGCCCCATGGCCTGCCTGG - Exonic
1096626378 12:52898586-52898608 CCAAGTCCCAAGGGGCTTCAGGG + Intronic
1097053008 12:56234958-56234980 GTAGATCCCCTGGGGGTGCAGGG - Exonic
1097711853 12:62925802-62925824 ACAGCTCCCCAAGGTCTGCAAGG + Intronic
1100191786 12:92200673-92200695 CCAGATGCCCAGTGGCAGGATGG - Intergenic
1101328814 12:103740710-103740732 ACAGATCCCCAGGTGCTGCAAGG + Exonic
1101970514 12:109309376-109309398 CCAGAACCCCGGGGCGTGCAAGG - Intergenic
1102535199 12:113575972-113575994 CCAACTCCCCAGGGGCAGCCTGG + Intergenic
1103535786 12:121633078-121633100 CCAGGTGCCCAGGGTCTCCATGG + Intronic
1103724499 12:122991005-122991027 CCAGCACCCCAGTGGCTCCAGGG + Intronic
1103859387 12:124000114-124000136 TCAGTTCCTCAGGGGCTGCATGG - Intronic
1104084079 12:125458501-125458523 TCAGCTCCCCAGGACCTGCAAGG - Intronic
1104286688 12:127430741-127430763 TCAGCTCCCCAGGACCTGCAAGG + Intergenic
1104787475 12:131459031-131459053 CCAGATCCGCAGGGAGGGCAGGG - Intergenic
1105508988 13:21035763-21035785 CCAGCTCCCAAAGGGCTGCAGGG + Intronic
1107949276 13:45447176-45447198 CCAGGACGCCAGGAGCTGCAGGG - Intergenic
1107964131 13:45584560-45584582 CCAGATCCCCAGAGGATGCTTGG - Intronic
1110250257 13:73373185-73373207 GCAGCTCCCCATTGGCTGCAGGG - Intergenic
1110569346 13:76988153-76988175 CCAGAGCCTCAGTGGCTGCCTGG - Intergenic
1113539272 13:111093774-111093796 CCAGATCTGCAGGGGGCGCAGGG - Intergenic
1113855840 13:113445051-113445073 CCAGAAACCCAGGTGCTGCAGGG + Intronic
1113923633 13:113928515-113928537 GCAGGTTCCCAGGGACTGCAAGG + Intergenic
1114430245 14:22654599-22654621 GCAGATCCCCAGAAGCAGCAGGG + Intergenic
1117243675 14:53861806-53861828 CCAGAGCTCCCGGGGATGCAGGG - Intergenic
1117337394 14:54766961-54766983 GGAGATCACCTGGGGCTGCACGG - Intronic
1119435740 14:74596751-74596773 CCAGCCACCCAGGGGCTACAGGG - Intronic
1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG + Intronic
1121007775 14:90501201-90501223 CCAAGGCCCCTGGGGCTGCAGGG - Intergenic
1121249883 14:92491657-92491679 CCATGTCCCCAAGGCCTGCAGGG - Exonic
1121600594 14:95200204-95200226 CCAGATCCAGAAAGGCTGCATGG - Intronic
1121653462 14:95576825-95576847 CCTGGCCCCCAGGGGCTCCAGGG + Intergenic
1121719527 14:96099493-96099515 ACAGAGCCCCAGTTGCTGCAGGG + Intergenic
1124632993 15:31347779-31347801 CCAGGGCCCCAGAGGCTGGAGGG - Intronic
1127716182 15:61651412-61651434 GCAGAACCCCAGGGGGTCCAAGG + Intergenic
1128114046 15:65094435-65094457 CCAGGGCCCCAGGGGATGGAAGG - Intronic
1128318758 15:66678195-66678217 CCAGATCGTCAGGGGCTCCTGGG - Intronic
1128482861 15:68054683-68054705 CCAGCTCCCCATGGGGGGCAGGG - Intronic
1130403726 15:83580103-83580125 CCAGAGTCCCATGGGCTACAAGG - Intronic
1131232097 15:90666810-90666832 GCAGATTCCCAGGAGCTGCCTGG - Intergenic
1132327443 15:100983545-100983567 CCAGATCCCCATAGGCTGCCGGG - Exonic
1132577920 16:672404-672426 CCACCACCCCAGGGGCTCCAGGG + Intronic
1132643505 16:988492-988514 CCCCCTCCCCAGGTGCTGCACGG + Intergenic
1133033632 16:3023066-3023088 CCAGGTCCCCAGGGGCTCCTGGG + Intronic
1136254511 16:29029308-29029330 CCTGATCCCAAGGTGTTGCAGGG - Intergenic
1136686112 16:31995888-31995910 CCTGGGCCCCAGGGGCTGCCGGG - Intergenic
1136786725 16:32939417-32939439 CCTGGGCCCCAGGGGCTGCCGGG - Intergenic
1136883047 16:33914373-33914395 CCTGGGCCCCAGGGGCTGCCGGG + Intergenic
1137371204 16:47907345-47907367 GCAGCTGCCCGGGGGCTGCATGG + Intergenic
1139634420 16:68249282-68249304 CCAAATCACCAGGGACTGCAGGG - Exonic
1140177656 16:72679942-72679964 GTAGATTACCAGGGGCTGCAGGG + Intergenic
1142063599 16:88047183-88047205 CCAGAGCTCCCGGGGCTGCCAGG + Intronic
1142167096 16:88597952-88597974 GCAGTTCCCCAGAGGCTGCCAGG - Intronic
1142178357 16:88655439-88655461 CGAGACCCCCAGCGGCTCCATGG - Intronic
1203088961 16_KI270728v1_random:1201087-1201109 CCTGGGCCCCAGGGGCTGCCGGG - Intergenic
1142762373 17:2050106-2050128 CCGGGTCCCTAGGGGCTGCGAGG - Intergenic
1143392463 17:6567801-6567823 GCAGATCTCCCGGGGCTGCTGGG + Intergenic
1143566099 17:7721705-7721727 CCCATTCCCCAGGGGCTGAAAGG - Intronic
1143594525 17:7906434-7906456 CCAAATCCCCAGGTGCTCCAGGG - Intronic
1144738364 17:17567443-17567465 GCAGTGCCCCAGGGGCAGCAGGG + Intronic
1144828976 17:18121340-18121362 GCAGAGCCCCAGGGGCGGCGAGG - Exonic
1146352982 17:32111473-32111495 CCAGAGCCCCAGGGGCCTCCTGG - Intergenic
1146662667 17:34674971-34674993 CCAGGTCCCCAGGGTGAGCAGGG + Intergenic
1147147074 17:38491556-38491578 CCTGGGCCCCAGGGGCTGCCGGG - Intronic
1147261897 17:39213615-39213637 CCAGGTGCCCAGGGTCTGCTAGG - Intronic
1147484237 17:40796937-40796959 CTGGATCTCCAGGGTCTGCAGGG + Exonic
1147572343 17:41579155-41579177 CCTGATCCCCAGGGGCTGGGGGG - Intergenic
1147586208 17:41655213-41655235 CCTGATCCCCAGGGTCTGGGTGG - Intergenic
1150098882 17:62404161-62404183 CCAGAGCCCTTGGGGCTGAAGGG - Intronic
1151428210 17:74044999-74045021 ACAGATAGCCAGGGGCAGCAAGG - Intergenic
1151677122 17:75604341-75604363 CCACATCCCCAGAACCTGCACGG + Intergenic
1152430929 17:80247990-80248012 CCAAGTCCTCAGGGGCTGCTTGG + Intronic
1152588641 17:81200282-81200304 CCAGACCCCCCGGGGGAGCATGG + Intronic
1152642786 17:81456155-81456177 CTCGATCCACAGGGGCTGAAGGG - Intronic
1152840981 17:82568070-82568092 CCCGCTCCCCGGGGGCTGGAGGG - Exonic
1152903889 17:82960227-82960249 CCAGCTCCCCAGGGGGTCTAAGG - Intronic
1153553095 18:6282951-6282973 CCAGGACCTCAGGGGCTGCCTGG - Intronic
1155228925 18:23755279-23755301 CCAGTTCTCCAGGGTCTCCAGGG - Intronic
1156475228 18:37401808-37401830 TCACTTCCCTAGGGGCTGCAAGG + Intronic
1160735668 19:661315-661337 CCAGGGCTCAAGGGGCTGCAAGG + Intronic
1160792497 19:929176-929198 GCTGATCCCCAGGGCCTTCATGG + Intronic
1160970230 19:1764677-1764699 CCAGCTCCCCGAGGGGTGCAGGG + Intronic
1162430881 19:10627710-10627732 TCTGCTCCCCAGGGGCTGCACGG + Exonic
1162524968 19:11201720-11201742 CCAGATCCCCAGGGAGGGGAGGG - Intronic
1162933699 19:13969952-13969974 CCAATTCCCCAGGGACTGCTGGG + Intronic
1163122105 19:15224114-15224136 CCAGATCGCCAGGGGCTGCGAGG - Intergenic
1163132057 19:15280487-15280509 GCAGATGGCCAGGTGCTGCAGGG - Intronic
1163445192 19:17341741-17341763 CCAGATCCCCCGAGGCTCCTGGG - Exonic
1163492947 19:17627678-17627700 AGGGATCCCAAGGGGCTGCAGGG + Intronic
1164548447 19:29188111-29188133 CCAGCGCCCCAGGGTCTCCATGG + Intergenic
1164672211 19:30078550-30078572 TCAGAGACCCTGGGGCTGCAGGG + Intergenic
1164735276 19:30536535-30536557 CTATAACCCCAGGGTCTGCAAGG + Intronic
1164877902 19:31705655-31705677 CCAGCTCACCTGGGGCTCCAGGG - Intergenic
1165437715 19:35805743-35805765 CAAGATCTGCAGGGGCTCCAGGG - Intronic
1165949259 19:39464790-39464812 CTTGATCTGCAGGGGCTGCAGGG - Exonic
1166919708 19:46221007-46221029 CCACAACCCCAGGTGCTGCTGGG - Intergenic
1167268983 19:48497751-48497773 CGAGAGCCCCAGGGGCTGGGAGG - Exonic
1167323016 19:48807792-48807814 CCTCAGCCCCAGGGGCTGAAGGG - Intronic
1168050179 19:53824030-53824052 CAAGATCCCCTGGGGAAGCATGG - Exonic
926684965 2:15691255-15691277 CCAGATCTCCAGGGAGGGCAGGG + Intronic
927188615 2:20500329-20500351 GCAGACCCCCAGGGGCAGGAAGG + Intergenic
927210936 2:20638627-20638649 CCAGATCCCCAGGGGCTGCAGGG - Exonic
927665843 2:25032228-25032250 CAAGCTCCCCAGGGGCTGCTTGG + Intergenic
927909587 2:26887432-26887454 CCAGCTCCCCTGGGCCTGCGGGG - Intronic
928102827 2:28449390-28449412 CAGGATCCTCAGGGCCTGCAGGG + Intergenic
929044491 2:37776711-37776733 CCACATCTCCAGGGACTGCTGGG - Intergenic
929075432 2:38076000-38076022 CCAGGTCCCCAAGGGCAGCGGGG - Exonic
929460769 2:42101064-42101086 TCGGATCAGCAGGGGCTGCAGGG + Intergenic
929464861 2:42135262-42135284 ACTGTCCCCCAGGGGCTGCAGGG + Intergenic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
931621438 2:64214008-64214030 TCAGATCTCTAGGGGCAGCACGG + Intergenic
932404993 2:71506848-71506870 CCAGAGCCTCTGGAGCTGCAGGG + Intronic
934763379 2:96868300-96868322 CCGGAGCCCCAGTGGCTGCAAGG - Intronic
934769800 2:96900444-96900466 CCAGGTGCCGAGGGGCAGCAGGG + Intronic
934950938 2:98575003-98575025 CCTTATCCCCAGGGGATGCCTGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936373033 2:111918984-111919006 CCAGAGCCCCAAAGGCTGGAGGG + Intronic
937857672 2:126684372-126684394 CCTGATCACCATGGGCTCCAGGG - Intronic
938069590 2:128301294-128301316 AGAGATCCCCAGGGGCTGCATGG + Intronic
941127564 2:161603578-161603600 GCAGATTCCCAGGGGCAGAAAGG + Intronic
946362721 2:219229014-219229036 CACGGCCCCCAGGGGCTGCACGG - Exonic
946745779 2:222844232-222844254 CCAGATGCTCAGGGGCTGGCAGG + Intergenic
947144766 2:227054719-227054741 CCAGGACCCCGGGGGCTGCCTGG - Exonic
948182124 2:235990334-235990356 CCTGACCCACAGAGGCTGCAGGG - Intronic
948360007 2:237413207-237413229 GCAGGGCCCCTGGGGCTGCAGGG - Intronic
948841461 2:240651872-240651894 CCAGATCCCCAGGAACTGGCTGG + Intergenic
1168800221 20:639979-640001 CCAGAGCCCCAGGTGATGCTTGG - Intergenic
1172890288 20:38259686-38259708 GCAGATTCACAGGGGCTGTAAGG - Intronic
1173163000 20:40666114-40666136 CCAGATCCAAAAGGGCAGCAAGG + Intergenic
1174385495 20:50186507-50186529 ATAGATCCCCAAGGGCTGCCAGG - Intergenic
1174544812 20:51317431-51317453 CCCCATCCCCATGGGCTGGAAGG - Intergenic
1175213003 20:57373183-57373205 GCAGAGCCCCATGGGCTGCGAGG - Intronic
1175290088 20:57869829-57869851 CCAGATCCCCTGGGGTGGGAGGG - Intergenic
1175367327 20:58465076-58465098 ACAGATCCCCGGGGGCTGTGGGG - Intronic
1175719838 20:61279397-61279419 CCAGAGACGCAGGGGCTGCCAGG - Intronic
1176199761 20:63854994-63855016 CCAGCTCCCCAGGGACGGCCTGG + Intergenic
1176413874 21:6463737-6463759 CCGGATCCACAGGGGCTCCTTGG + Intergenic
1176545635 21:8196769-8196791 CCGGAGCCCCAGGGCATGCAGGG + Intergenic
1176564586 21:8379814-8379836 CCGGAGCCCCAGGGCATGCAGGG + Intergenic
1176679873 21:9813704-9813726 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1176680160 21:9815113-9815135 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1176680443 21:9816522-9816544 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1176680726 21:9817931-9817953 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1176681293 21:9820753-9820775 CCGGAGCCTCAGGGGCTGCCTGG - Intergenic
1176681577 21:9822162-9822184 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1176681861 21:9823571-9823593 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1177089066 21:16743451-16743473 CCACATTCCCAGAAGCTGCAGGG + Intergenic
1179689372 21:43072059-43072081 CCGGATCCACAGGGGCTCCTTGG + Exonic
1180988148 22:19917644-19917666 GGAGATCCCCAGGGGCTGACAGG + Intronic
1181012786 22:20052264-20052286 CATGAACCCCAGGGGCTGCCTGG + Intronic
1181440124 22:22931410-22931432 GCTGGTCCCCAGGGGCTGCTGGG + Intergenic
1182245642 22:28955466-28955488 GCTGATCCACAGAGGCTGCAAGG - Intronic
1182477357 22:30583388-30583410 CCAGATTATCAGGGGCTCCAGGG - Intronic
1182622306 22:31624858-31624880 CCAGAGCCGCAGAGGCTGGACGG + Intronic
1183313567 22:37124835-37124857 CCAGGGCCCCAGCGGCTGCCCGG + Intergenic
1183469147 22:37996507-37996529 CAAGCTCTCCAGGGGCTGCCAGG - Intronic
1183513005 22:38246819-38246841 CGAGACACCCAGGGGCTGCCTGG - Intronic
1183578218 22:38706023-38706045 CCAGCTCCCCGGGGGCGGCCAGG + Exonic
1183686722 22:39365265-39365287 CCAGATCTGCAGGGACAGCAAGG - Intronic
1183721949 22:39567783-39567805 CCATCTCTCCAGGGGCTGAAGGG - Intergenic
1184729658 22:46365595-46365617 CCTCATGCCCAGGAGCTGCAAGG - Exonic
1185053664 22:48566828-48566850 GCAGAACCACAAGGGCTGCATGG - Intronic
1203250506 22_KI270733v1_random:113006-113028 CCGGAGCCCCAGGGCATGCAGGG + Intergenic
950084621 3:10248647-10248669 CCAGCTCCCGAGGGGCCGCTCGG + Exonic
950187081 3:10951889-10951911 CCACATCCCCAAGGGCTGCAGGG - Intergenic
950422309 3:12906314-12906336 CAAGCTCCCCAGCGGCAGCATGG - Intronic
950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG + Intergenic
950487630 3:13282551-13282573 CCAGACCCCCAGGGGCTCCCTGG - Intergenic
950494202 3:13324067-13324089 CCACATCCCTGGGAGCTGCAGGG - Intronic
950503940 3:13381894-13381916 CCAGCTCCGCAGGAGCTCCATGG - Intronic
951558847 3:23945992-23946014 CCACATTCCCCGGGGCCGCAGGG + Intronic
952888142 3:38024413-38024435 CCGGATCCCCAGGCACTGCATGG + Exonic
953169969 3:40498064-40498086 CCAGATCCCTGGGTGCTGCTTGG + Intergenic
953398422 3:42591007-42591029 CGGGATCCCGAGGGGCTGCGGGG + Intronic
953702625 3:45208482-45208504 CCTGATCCCCAAGGGCTGCATGG - Intergenic
954135300 3:48579587-48579609 CCCTTTCCCCAGGGGCTCCAGGG + Exonic
954360861 3:50122179-50122201 CCAACTCCCCATGGGCTGTAGGG - Intergenic
954433394 3:50483307-50483329 CCAGCTCCTCAGGGTCTCCAAGG - Intronic
954464300 3:50645702-50645724 CCAGGACCTCAGGGGCTGCCAGG - Exonic
954687793 3:52379997-52380019 CCAGCTCCTCAAGCGCTGCATGG + Exonic
955195722 3:56803130-56803152 CCAGTTCCCCTGTGGCTGAAGGG + Intronic
955344743 3:58152733-58152755 CCAGATCCTGTGGGGCTGGAGGG + Intronic
956589904 3:70903710-70903732 CCATATCCCCAGACCCTGCAAGG + Intergenic
956710921 3:72038123-72038145 CCAGACCCCCAGTGGATGCCTGG + Intergenic
960971550 3:123143487-123143509 CCGGCTCCCCTGGGGCTGCCAGG + Intronic
961675221 3:128560864-128560886 CCTGGTCCCCAGTGGCAGCAGGG + Intergenic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
966378645 3:179322737-179322759 CCAGTTCCCCAGGGCTTGAAGGG + Intergenic
966920347 3:184607209-184607231 CCCACTCCCCATGGGCTGCAGGG + Intronic
968061545 3:195729781-195729803 CGAGGTTCGCAGGGGCTGCAGGG + Intronic
968736673 4:2300833-2300855 CCACAACCACAGGGGCTGCAGGG + Intronic
968743139 4:2341294-2341316 CCAGATCCTCCAGGGGTGCACGG + Intronic
968802290 4:2751103-2751125 CCAGAAGCCCGGGGGCTGGAGGG - Intronic
969429375 4:7145267-7145289 TCAGCTGCCCAGGGGCAGCAGGG - Intergenic
969470554 4:7385120-7385142 CCAAAGCCCTAGGGTCTGCAGGG + Intronic
969796822 4:9533228-9533250 ACAGCGCCCCAGGGGATGCAAGG - Intergenic
969844698 4:9911235-9911257 CCCGCTGCCCAGGGGCTACAGGG + Intronic
970600324 4:17636830-17636852 TCAGGTCCCCTGAGGCTGCAGGG + Intronic
971082951 4:23236101-23236123 CCTGATCCCCTGTGGATGCAGGG - Intergenic
973191463 4:47390586-47390608 AGAAATCCCCAGGGGCTGAAAGG + Intronic
982084327 4:151818268-151818290 CCAGCTCTCCTGGTGCTGCAGGG + Intergenic
982158140 4:152540925-152540947 ACAGACACCCAGGGCCTGCAAGG + Intergenic
984685221 4:182659480-182659502 CAAGATCCCCAGTGGATGCCTGG - Intronic
984936758 4:184896878-184896900 AGAGGTCGCCAGGGGCTGCAGGG + Intergenic
985034016 4:185820470-185820492 CCAGATGCCAAGGGGCTGCCAGG + Intronic
985488224 5:163576-163598 CTAGATCCCCAAGGACTGCTAGG - Intronic
986004866 5:3659166-3659188 CCAGAGCCCCAGGGACTCCACGG - Intergenic
987114340 5:14714251-14714273 CCATTTCACCAAGGGCTGCATGG + Intronic
992614418 5:78535202-78535224 CCATTTGCCGAGGGGCTGCACGG + Intronic
992701156 5:79343116-79343138 GCACTTCCCCAGGTGCTGCAGGG - Intergenic
995372569 5:111435575-111435597 CAAGATCCCCAGGTTCTGCTTGG + Intronic
995730051 5:115229257-115229279 CCAGATACCCAGGTCCTGCTTGG + Intronic
996024395 5:118628946-118628968 CCAAATCCAAAGGGGCTGGAAGG - Intergenic
997980191 5:138464091-138464113 ACGGCTCCCCAGGGACTGCAGGG + Intergenic
998769965 5:145531651-145531673 CCATTTCCCCAGGCTCTGCAAGG + Intronic
999296039 5:150459953-150459975 CCAGATCCTCTGGGCCTGCTAGG + Intergenic
999340379 5:150765005-150765027 CCCTCACCCCAGGGGCTGCAAGG - Intergenic
999738693 5:154532642-154532664 GCAGTTTCCCAGGGACTGCAAGG + Intergenic
999829536 5:155305626-155305648 CCAGATGCCCAGGGGAAGGAGGG - Intergenic
999945740 5:156593266-156593288 CCAGATGCCCAGTGGCTGGTTGG + Intronic
1003006606 6:2388718-2388740 CCAGCTCCCCAGGAGTTGCTTGG + Intergenic
1003324339 6:5081396-5081418 CGAAGTCCCCATGGGCTGCAAGG + Intergenic
1005464228 6:26096043-26096065 CCGGAACCCCAGTGGCTCCATGG - Exonic
1006169226 6:32083559-32083581 CCAGAACCCTGGGGGCTGCCTGG + Intronic
1007239126 6:40412498-40412520 CCAGAGCTCCAGGTCCTGCATGG - Intronic
1007829521 6:44627730-44627752 GTAGATCCCCCGGGGCTCCAGGG - Intergenic
1010652154 6:78467851-78467873 CCAGATCTCCAGCTGCTGCTGGG - Intergenic
1010760470 6:79716687-79716709 CAAGATCCCCAGGTGATTCAGGG + Intergenic
1013374747 6:109503738-109503760 CCAGGTGCCCAGCAGCTGCAGGG - Intronic
1019485934 7:1289196-1289218 CCAGATCTTCCGGGGCTGCGGGG - Intergenic
1019563621 7:1669492-1669514 GCAGAGCCCCAGGGGCAGCCTGG - Intergenic
1019985366 7:4651500-4651522 CCTGGTCCCCAGGGGCTGTGAGG - Intergenic
1020027050 7:4906609-4906631 ACAGAACATCAGGGGCTGCATGG + Exonic
1021958986 7:25853544-25853566 CCAGATCCTTAGTGTCTGCAGGG - Intergenic
1024281513 7:47723084-47723106 GCAGAACCCCATGGGCTGGATGG - Intronic
1027450547 7:78326502-78326524 ACAGATCCCCAGGACCTGAAAGG + Intronic
1028121453 7:87059808-87059830 GCGGGTCCCCAGGGGCTGCGCGG + Intergenic
1031862779 7:127000693-127000715 ACAGATTACCAGGGGCTGGAGGG + Intronic
1032083130 7:128869880-128869902 CGCGATCCGCACGGGCTGCAGGG - Intronic
1034242956 7:149624096-149624118 CCAGCTCCCCAGGGTCGGCGCGG - Intergenic
1034269710 7:149797647-149797669 CCGGGTCCCCAGGGGCTTCCCGG + Intergenic
1034928803 7:155144172-155144194 GCAGCTCCCCAGGGTCAGCAGGG + Intergenic
1035243203 7:157545576-157545598 CCAGGCACCCAGGGGCTGAACGG - Intronic
1035589614 8:802563-802585 CCAGGCGCTCAGGGGCTGCATGG + Intergenic
1036648487 8:10626512-10626534 ACAGGTCCACACGGGCTGCATGG + Intronic
1036791632 8:11725131-11725153 CCAGCCCCACAGGGACTGCATGG - Intronic
1037742139 8:21616388-21616410 CCTGACCCCCAGGGGCCACAGGG + Intergenic
1038571565 8:28667052-28667074 CCAGATCCTCTGGGGCGGCAAGG + Intronic
1038824953 8:30989950-30989972 CTAGGATCCCAGGGGCTGCAAGG - Intergenic
1039610191 8:38913547-38913569 ACAGATTTGCAGGGGCTGCAAGG - Intronic
1039981022 8:42410198-42410220 GCAGAGGCCCAGCGGCTGCACGG + Intergenic
1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG + Intergenic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1043152341 8:76733455-76733477 CCAGAGCCCCAGGGGCTGTCAGG + Intronic
1044834629 8:96283723-96283745 CCAGCTGCCCAGGAGCTCCAGGG - Intronic
1044927706 8:97223678-97223700 CCAGATCCCCTGTGGTTGCCTGG - Intergenic
1049475149 8:142793851-142793873 CCAGGACCCCAGGGGCTTAAGGG + Intergenic
1049546786 8:143235802-143235824 ACAGGTCCCAAGGGGCTCCATGG - Intergenic
1049671719 8:143873001-143873023 CCAGGCCCCCAGTGGCTGCCTGG + Exonic
1050425522 9:5508999-5509021 GCAGATCCCCAGAGGAAGCACGG + Intergenic
1052795804 9:32922272-32922294 CCATATCACTAGGGGCTGAAGGG + Intergenic
1053471260 9:38347323-38347345 CCAGAACCCAAGGGGCTGAAGGG - Intergenic
1055493020 9:76825513-76825535 CCCCATCCCCAGGGGCAGGAGGG - Intronic
1056708092 9:88968806-88968828 ACTGAGCCCCGGGGGCTGCAGGG + Intergenic
1056954975 9:91074408-91074430 CCAGCTTCCCAGGGGCTCCTGGG + Intergenic
1057152948 9:92809918-92809940 CCCCCGCCCCAGGGGCTGCAGGG - Intergenic
1057275710 9:93675091-93675113 CCACATTCTCAGGGGCTGGAGGG - Intronic
1058866628 9:109167103-109167125 CCAGACCCCCGGGTGCTGCCGGG + Exonic
1059404820 9:114093136-114093158 CCAGAGCCCCAGGGATTCCAGGG - Intronic
1059435850 9:114275784-114275806 CCAGAGCTCCAGGCGCTGCAAGG - Intronic
1059879370 9:118672935-118672957 CCAGATCCGCATGGGCAACAAGG - Intergenic
1060790598 9:126483086-126483108 ACAGAACCCCAGGGCCCGCATGG - Intronic
1060895121 9:127212249-127212271 CCACATCCACCGGGGCAGCAGGG + Intronic
1061873114 9:133531163-133531185 GCAGAGCCCGAGGGGCTGCTGGG + Intergenic
1062028776 9:134352627-134352649 CCAGCACCCCGGGAGCTGCAGGG - Intronic
1062084236 9:134640814-134640836 CCCCTTCCCCAAGGGCTGCAGGG - Intergenic
1062168284 9:135119877-135119899 CCAGGTCTGCAGGGTCTGCAGGG - Exonic
1062206550 9:135340854-135340876 ACAGCTGCACAGGGGCTGCACGG + Intergenic
1062587607 9:137256385-137256407 GCACATCACCACGGGCTGCAGGG - Exonic
1203466908 Un_GL000220v1:96278-96300 CCGGAGCCCCAGGGCATGCAGGG + Intergenic
1203664755 Un_KI270754v1:14829-14851 CCGGAGCCTCAGGGGCTGCCTGG - Intergenic
1203665040 Un_KI270754v1:16238-16260 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1203665601 Un_KI270754v1:19055-19077 CCGGAGCCTCAGGGGCTGCCTGG - Intergenic
1203666176 Un_KI270754v1:21874-21896 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1203666750 Un_KI270754v1:24693-24715 CCGGAGCCTCAGGGGCTGCCTGG - Intergenic
1203667325 Un_KI270754v1:27513-27535 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1203667899 Un_KI270754v1:30332-30354 CCGGAGCCTCAGGGGCTGCCTGG - Intergenic
1203668473 Un_KI270754v1:33152-33174 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1203669039 Un_KI270754v1:35969-35991 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1203669317 Un_KI270754v1:37378-37400 CCGGATCCTCAGGGGTTGCCTGG - Intergenic
1187139414 X:16578180-16578202 CCAGGTGACCAGGGGCTTCATGG + Intergenic
1187407274 X:19015355-19015377 CCCGAACCTCAGGGGATGCAGGG - Intronic
1187424266 X:19162869-19162891 CCAGATCCTGAGGGGCTGCGAGG + Intergenic
1189186789 X:39061795-39061817 GCAGATTTCCAGGTGCTGCAGGG - Intergenic
1190263563 X:48814733-48814755 CCAGATCCCCAGGACCTCGAGGG - Exonic
1190329096 X:49224805-49224827 TGAGATGCCCAAGGGCTGCATGG + Exonic
1190819740 X:53962176-53962198 CCAGATTCCCTGGGGCTGAATGG - Intronic
1192307041 X:69972337-69972359 ACAGAACCCCAAGGGCTCCAGGG - Intronic
1195394902 X:104399896-104399918 CCAGATACCCAGGGGGTGGGCGG + Intergenic
1197856025 X:130914961-130914983 CCAACTCCTGAGGGGCTGCAAGG + Intergenic
1199350484 X:146794856-146794878 CCAAGTCCCAAGGGGATGCAGGG - Intergenic
1200002385 X:153068750-153068772 CCAGATCCCCAGGAGCAGCGTGG + Intergenic
1200005339 X:153081260-153081282 CCAGATCCCCAGGAGCAGCGTGG - Intergenic
1200119045 X:153781855-153781877 CCAGCTCCCCTGGAGCTGCCTGG + Intronic