ID: 927213339

View in Genome Browser
Species Human (GRCh38)
Location 2:20651735-20651757
Sequence TTGGGTCCCCAGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 2, 2: 1, 3: 22, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927213336_927213339 -7 Left 927213336 2:20651719-20651741 CCTGGGATGGCTGCACTTGGGTC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224
927213323_927213339 23 Left 927213323 2:20651689-20651711 CCTGGTGGAGGCCTCCCGGGGCC 0: 1
1: 0
2: 1
3: 35
4: 278
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224
927213330_927213339 8 Left 927213330 2:20651704-20651726 CCGGGGCCGGGCCTGCCTGGGAT 0: 1
1: 0
2: 2
3: 47
4: 477
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224
927213329_927213339 9 Left 927213329 2:20651703-20651725 CCCGGGGCCGGGCCTGCCTGGGA 0: 1
1: 0
2: 6
3: 71
4: 577
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224
927213326_927213339 12 Left 927213326 2:20651700-20651722 CCTCCCGGGGCCGGGCCTGCCTG 0: 1
1: 0
2: 3
3: 58
4: 432
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224
927213332_927213339 2 Left 927213332 2:20651710-20651732 CCGGGCCTGCCTGGGATGGCTGC 0: 1
1: 0
2: 6
3: 47
4: 429
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224
927213333_927213339 -3 Left 927213333 2:20651715-20651737 CCTGCCTGGGATGGCTGCACTTG 0: 1
1: 0
2: 1
3: 25
4: 203
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224
927213322_927213339 24 Left 927213322 2:20651688-20651710 CCCTGGTGGAGGCCTCCCGGGGC 0: 1
1: 0
2: 1
3: 28
4: 177
Right 927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG 0: 1
1: 2
2: 1
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927213339 Original CRISPR TTGGGTCCCCAGCTGGAGCA GGG Intergenic
902282506 1:15384675-15384697 CAGCGTCCCCAGCTGGAGCTGGG + Intronic
902361586 1:15945085-15945107 GAGGGTTCCCAGCTGGAGAACGG - Exonic
902782700 1:18714994-18715016 TGGGGTCCCCTGCAGGAGGAAGG + Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
903129813 1:21271553-21271575 TAGGGTCCCAGGATGGAGCAGGG + Intronic
903156338 1:21446114-21446136 TGAGGTCCCCAGCTGCAGCTGGG + Intronic
903297726 1:22355832-22355854 TTGGTTCCCCAGTTTCAGCAGGG + Intergenic
903369442 1:22825787-22825809 TTGGTTTCCCACCTGCAGCAGGG - Intronic
905168579 1:36097671-36097693 GTTGGGCCGCAGCTGGAGCACGG + Exonic
905928613 1:41770403-41770425 TTCGTTCCCCTGCTTGAGCATGG + Intronic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
907394059 1:54177383-54177405 TTTAGTCCCCAGCTGGGCCAGGG - Intronic
907540787 1:55214621-55214643 TTCGGTTCCCAACTGGAGCCTGG + Intronic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
914300866 1:146376365-146376387 TTCGGTGGCCAGCTGGAGCCTGG - Intergenic
917686814 1:177424697-177424719 TGAGTTCCCTAGCTGGAGCAAGG + Intergenic
919797983 1:201332702-201332724 TTGGGTCCCCAGGAGGAGTGTGG - Exonic
920078550 1:203354982-203355004 TTGTGTGCCCAGCTGGGACAGGG - Intergenic
922222343 1:223618331-223618353 CTGGGTCCTCACCTGGTGCAAGG - Intronic
922796705 1:228343089-228343111 CTGGGTCCCCAGCTCCAGCACGG - Intronic
922797813 1:228349847-228349869 TTGGGTCCCCACCTGGGTGACGG + Intronic
1063310396 10:4946544-4946566 TTGGGTCCCCAGATGATGTAAGG - Intronic
1063880053 10:10522000-10522022 TTGAAACCCCAGCTGGACCATGG - Intergenic
1066602572 10:37124739-37124761 GTGGGTCCCCGGCTGCAGGAGGG + Intergenic
1067318871 10:45198763-45198785 GTGGGTCCCCAGCTGCAGGAGGG - Intergenic
1067319544 10:45205214-45205236 ATGGGTTCCCAGCTGCAGGAGGG - Intergenic
1068286251 10:54939796-54939818 TTGTGTCCTCAGATGGTGCAAGG + Intronic
1069561887 10:69436305-69436327 TTGGGTCTGCAGCTGTAGCTGGG + Intergenic
1070786045 10:79162803-79162825 GTGGGTCCTCAGGGGGAGCAGGG - Intronic
1070788695 10:79177049-79177071 CTCGGTTCCCAGCTGCAGCAGGG + Intronic
1072887908 10:99296686-99296708 TTGGGTACCAAGCTGATGCAGGG - Intergenic
1075080625 10:119381264-119381286 ATGGGTTCTCAGCTGGAGGAAGG - Intronic
1077328231 11:1972821-1972843 TTGGGTCTGCAGCTGGCGCATGG - Intronic
1077800232 11:5529484-5529506 TCTGGTCCTCAGGTGGAGCATGG - Intronic
1078017406 11:7626852-7626874 TTGGATCCCCAGCTGGGGTGTGG + Intronic
1078146450 11:8724906-8724928 TGGGCTCCCCAGCTGGGACATGG + Intronic
1081088005 11:38824528-38824550 TTTGGTACCCAGCTGCAGCTTGG - Intergenic
1081566857 11:44265634-44265656 TTGGGCCCCCACCAGTAGCAGGG + Intronic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1084146722 11:67268974-67268996 TTGGGTCACCATCAGCAGCATGG + Intronic
1084288759 11:68148318-68148340 TTGGTTCCCCAGCAGAAACAGGG + Intergenic
1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG + Intergenic
1085318336 11:75559497-75559519 GTGAGTCCCCAGCTCCAGCAAGG - Intergenic
1085403778 11:76249823-76249845 TGGGGACTCCAGCTGTAGCAGGG + Intergenic
1087339017 11:96878689-96878711 TTGGGTCTGCAGCTGCAGCTTGG + Intergenic
1090558070 11:127898512-127898534 TTGGATCCCATGCTGGGGCAGGG + Intergenic
1090988649 11:131796163-131796185 TTGTTTCCCCAGCTGCAGGAGGG - Intronic
1202811210 11_KI270721v1_random:28001-28023 TTGGGTCTGCAGCTGGCGCATGG - Intergenic
1096900946 12:54881388-54881410 ATGGTTCCCCAGGTGGATCAAGG - Intergenic
1098159177 12:67632068-67632090 TTGTTCCCCCAGCAGGAGCAGGG + Intergenic
1098237568 12:68432266-68432288 TTGTCTCTCCAGCTAGAGCAGGG + Intergenic
1098461429 12:70736965-70736987 ATGGGGCACCAGCTGGAGAAAGG - Intronic
1100583199 12:95955722-95955744 TAGCGTCACCAGCTGGAGGATGG + Intronic
1105239545 13:18597774-18597796 GTTGGTCCCCAGCTGCAGGAGGG - Intergenic
1105931446 13:25056539-25056561 TGGGCTCCCCAGCTGTAGCATGG + Intergenic
1107709797 13:43140525-43140547 TTGGGTACCTTGCTGGAGAATGG + Intergenic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1109635891 13:65115537-65115559 TTGGGCACCCATTTGGAGCAAGG - Intergenic
1109734746 13:66468066-66468088 TTAGATATCCAGCTGGAGCATGG - Intronic
1112264034 13:97906192-97906214 TTGGGCCCCCTCCTGGAGCTAGG + Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115345583 14:32339572-32339594 TTGGGTCCCCTTCAGGAACAGGG + Intronic
1117351936 14:54889772-54889794 CTGGGTCTCCAGCTCCAGCAAGG + Intronic
1117980459 14:61337715-61337737 ATGAGTCCCCAGGTGGGGCATGG - Intronic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1119133607 14:72196505-72196527 TTGGGTTCCCAGGAGGAACAGGG - Intronic
1120964968 14:90158905-90158927 GTGGGTCCCCAGTTGGAAGAGGG + Intronic
1121216694 14:92253931-92253953 TTGGTTCCCCAACAGGACCAAGG - Intergenic
1121777468 14:96599919-96599941 ATTGGTCCCCAGCTCAAGCATGG - Intergenic
1122504508 14:102223040-102223062 TTGGGTGAGCAGCGGGAGCACGG - Intronic
1122519552 14:102333867-102333889 CTGGGTTCCCAGCTTGAGCCTGG - Intronic
1123491702 15:20786310-20786332 GTTGGTCCCCAGCTGCAGGAGGG + Intergenic
1123548204 15:21355404-21355426 GTTGGTCCCCAGCTGCAGGAGGG + Intergenic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1128285827 15:66436261-66436283 TTGTCTCCCCAGCTGGAACAAGG + Intronic
1129360425 15:75020773-75020795 TTGGGTTCCAAGCTGAAGCCAGG - Exonic
1130709943 15:86270184-86270206 TTGGGTTGCCAGGTGCAGCAAGG + Intronic
1202956536 15_KI270727v1_random:82634-82656 GTTGGTCCCCAGCTGCAGGAGGG + Intergenic
1132575657 16:662594-662616 CTGGGTCCCCAGCCGAGGCAGGG - Intronic
1132710065 16:1262554-1262576 GGGGCTCACCAGCTGGAGCAGGG + Intergenic
1132959567 16:2614323-2614345 TTGTGTCGCCAGCCGGAGCCTGG - Intergenic
1132972628 16:2696298-2696320 TTGTGTCGCCAGCCGGAGCCTGG - Intronic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1137343757 16:47636307-47636329 TGGGGACACCAGCTGCAGCAGGG + Intronic
1138505563 16:57476663-57476685 TTGGGTTCCCAGCTGGAGCAGGG - Intronic
1138717015 16:59035428-59035450 TAGGGCCTCCAGATGGAGCACGG - Intergenic
1138878241 16:60979232-60979254 CTGGGTCCCCAGCTGCAGTTTGG - Intergenic
1139149867 16:64369452-64369474 TTGGGTCTCCAGATTGACCATGG - Intergenic
1140456361 16:75107791-75107813 TTGGGACACCAGCGGGAACAGGG + Exonic
1140482195 16:75267641-75267663 GTGGGCCCCAAGCAGGAGCAAGG - Intronic
1141002737 16:80323635-80323657 TAGAGTCCTCAGCGGGAGCACGG - Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1149557701 17:57585875-57585897 TCGTGTGCGCAGCTGGAGCAAGG - Intronic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1150627091 17:66848720-66848742 TTGGGTCACCAGCTGGGGTAGGG - Intronic
1151801005 17:76379771-76379793 CTGGGTCCCCAGCCTCAGCAAGG + Intronic
1152272242 17:79331450-79331472 TTGGGTCCCCAGGTTCAGCTTGG - Intronic
1152400473 17:80063536-80063558 TTGGGTCCCCACCTGCTGCCTGG + Intronic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1152862263 17:82703254-82703276 GTGGTTCCCACGCTGGAGCAGGG + Intergenic
1153916848 18:9753416-9753438 TAGAGTCCCAAGGTGGAGCAGGG - Intronic
1154475096 18:14747887-14747909 GTCGGTCCCCAGCTGCAGGAGGG + Intronic
1154529891 18:15332272-15332294 ATGGTTCCCCAGCTGCAGGAGGG + Intergenic
1157529403 18:48409027-48409049 TTGGGGCGCCGGCTGGAGCAGGG - Intronic
1159102283 18:63970375-63970397 TTGGGACCCCGGCTGGTGCCAGG - Intronic
1159678801 18:71321009-71321031 TTGGGTCTCCAGCTTGCACAGGG - Intergenic
1160901227 19:1429678-1429700 TGGGGTCCTCAGGTGGAGCCGGG + Intronic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161326873 19:3668272-3668294 TGGGGTCCTCATCTGGAGAACGG + Intronic
1162090823 19:8278816-8278838 TTGGCTCCCAAGCTGGAGTACGG - Intronic
1162093056 19:8293654-8293676 TTGGCTCCCAAGCTGGAGTACGG - Intronic
1162477956 19:10912227-10912249 TTGCCGCCCAAGCTGGAGCACGG + Exonic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1163235113 19:16025361-16025383 TTGGGGCCCCAGCGGGCTCAAGG + Intergenic
1164674605 19:30092994-30093016 TTGGGTCCTCATCTGGAAAATGG + Intergenic
927210091 2:20633961-20633983 TTGGGTCCCCAGCCAGGCCAGGG + Intronic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929876805 2:45803602-45803624 TTTGGTCCCCAGCTGTAGGTTGG + Intronic
937370973 2:121296839-121296861 TGGGGACACCAGCTGCAGCAGGG - Intergenic
937872909 2:126798687-126798709 TGGGGACCCCTGCAGGAGCAGGG - Intergenic
938310532 2:130285933-130285955 TTGGGCCCCCTGGAGGAGCAGGG + Intergenic
938444393 2:131366434-131366456 TTGGGTCCCCTGGGGGAGCAGGG - Intergenic
938528988 2:132163712-132163734 ATGGGTCCCCAGCTGCAGGAGGG + Intronic
938631715 2:133174721-133174743 TTGATTCCAAAGCTGGAGCAGGG - Intronic
940460817 2:153960298-153960320 TTGGGTGCCAAGCTGATGCAGGG + Intronic
942078494 2:172379190-172379212 TCGGCTCCCCAGCTGGTGAAAGG - Intergenic
942671047 2:178376790-178376812 TTGTGTCCCTTGCTGTAGCAAGG + Intronic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
947543750 2:230996112-230996134 TTGGGCCTCCAGCTGGACCCAGG - Exonic
948350637 2:237337789-237337811 TTGGCACCCGAGATGGAGCAGGG + Intronic
948823157 2:240560517-240560539 TTGGGTCCCCCGCGGGCGCTGGG - Exonic
1168810517 20:701659-701681 CTGGTCCCCCACCTGGAGCAGGG - Intergenic
1168832522 20:854446-854468 TGGGGTGCCAAGCTGGAGCCAGG + Intronic
1173919783 20:46735004-46735026 GAGGGTCCCCAGCTGGTCCAGGG + Exonic
1175212977 20:57373075-57373097 CTGCCTCCCCAGCTGGAGGAGGG - Intronic
1175876077 20:62230832-62230854 TCGGGTTCCCAGCTGCAGCCAGG - Intergenic
1176102376 20:63370367-63370389 GTGGGCCCCCAGCTGGGGCCAGG - Intronic
1176446924 21:6829532-6829554 ATTGGTCCCCAGCTGCAGGAGGG - Intergenic
1176767520 21:13036204-13036226 ATGGGTCCCCAGCTGCAGGAGGG - Intergenic
1176825095 21:13694558-13694580 ATTGGTCCCCAGCTGCAGGAGGG - Intergenic
1178076653 21:29019019-29019041 CGAGGTCCCCGGCTGGAGCAGGG + Intronic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1179569523 21:42269807-42269829 TTGGGTGCCCAGCTGGGGACCGG + Intronic
1181820098 22:25468799-25468821 TTTGCTCCCCATCTCGAGCAGGG + Intergenic
1182300339 22:29333493-29333515 TGGGCTTCTCAGCTGGAGCAGGG + Intronic
1182618543 22:31604966-31604988 CTTGTTCCCCAGCTGGAGCTTGG - Intronic
1183742292 22:39675478-39675500 TTGGGTCTCCTGCTGGAGGCTGG - Intronic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1185177918 22:49340631-49340653 CTGGCTCCCCAGCCTGAGCATGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
950446600 3:13042372-13042394 TTTGGTCTCCAGCTGGACCACGG + Intronic
950546980 3:13644029-13644051 TTGGGTCCCCAGCTAGGGGGTGG + Intergenic
951755945 3:26091358-26091380 TTTGGTCCCCACTTGAAGCAGGG - Intergenic
952998718 3:38910093-38910115 TTGGGTCATCAGCCGGAACATGG + Exonic
953171630 3:40512425-40512447 CTGGTCTCCCAGCTGGAGCAAGG + Exonic
954063554 3:48088678-48088700 TGGGGTACCCAGCTGCCGCAGGG + Intronic
954442936 3:50531558-50531580 TGGGGTGTCCATCTGGAGCATGG + Intergenic
955364274 3:58298292-58298314 TGGTGTCCCCAGCTGCCGCAGGG + Intergenic
960696984 3:120405976-120405998 ATGGCTCCCCAGATGGTGCAAGG + Intronic
967790041 3:193538929-193538951 TTGTGCCCCAAGCTGGAGCACGG + Intronic
968135746 3:196218234-196218256 TTGGGTCCCCAGATGGCTCTGGG - Intronic
968655263 4:1775821-1775843 TGGCCTGCCCAGCTGGAGCATGG - Intergenic
969322930 4:6424027-6424049 CAGGGTCCCCGGCTGGAGGAAGG + Intronic
969987061 4:11223358-11223380 TTGGGGCAACTGCTGGAGCAGGG + Intergenic
972066589 4:34953423-34953445 TTTGGGCGCCAGCAGGAGCATGG - Intergenic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG + Intergenic
979203335 4:118005437-118005459 TTGTGTACCTAGCTGGAACAAGG - Intergenic
980251628 4:130322820-130322842 ATGATTCCCCAGCTGAAGCAGGG - Intergenic
981162633 4:141517033-141517055 ATGCCTCCCCAGCAGGAGCAAGG + Intergenic
982943239 4:161585205-161585227 TGGGTTTCCCAGCTGGAGCATGG + Intronic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
985054405 4:186023901-186023923 CTGGGTGCCCAGCTGGGCCAGGG - Intergenic
985491773 5:184104-184126 TTGGGTCTCCAGCTTGTGGATGG - Exonic
985666690 5:1184735-1184757 TTGGGCCCCCAGCTGGAAGATGG + Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
988533305 5:32043662-32043684 TTGTCTCCCAGGCTGGAGCACGG + Intronic
988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG + Intergenic
994163271 5:96580940-96580962 TTGTGTCCTCACATGGAGCAAGG - Intronic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
999754961 5:154657430-154657452 TTGGGTCTCCAGCTGGAACAAGG - Intergenic
1000320112 5:160127755-160127777 TTGGGTCCCCAGCTTGCACATGG + Intergenic
1001003377 5:168028737-168028759 TTGGGTCCCTAAATCGAGCAGGG + Intronic
1001417235 5:171554696-171554718 ATGGCTCCCCAGTTGGAGAAAGG - Intergenic
1002026652 5:176400486-176400508 TTGGGTCCCCAGCTCTGGCAAGG - Intronic
1002571787 5:180143773-180143795 TGGGGACCCCAGCAGGAACAGGG - Intronic
1002602549 5:180362219-180362241 GGGGGTGCCCAGCTGGAGAAAGG - Intergenic
1003167733 6:3695975-3695997 ATTGTTCCCCAGCTGGAGGAAGG - Intergenic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1006579610 6:35069168-35069190 TTGGGTCTCCAGAGGGAGCCTGG - Intronic
1006992232 6:38225175-38225197 TTGGTTCCCTAGCTGGAGTGAGG - Intronic
1007446093 6:41907277-41907299 TTTGGTTCCCAGGTGGAGTATGG - Exonic
1008546825 6:52590563-52590585 TGGGGTCCCCAGAGGCAGCAGGG - Intergenic
1010073509 6:71772625-71772647 TTGGGTCCCCAGATGAACAATGG + Intergenic
1012290083 6:97443630-97443652 CTGGCTCCCCAGATGTAGCATGG + Intergenic
1013115841 6:107103192-107103214 CTGCATCCCCAGCTGGCGCAGGG + Intronic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1015729766 6:136335588-136335610 TTGAGTCCCGAGTTGGGGCAGGG + Intergenic
1017648696 6:156562279-156562301 TTGGGTTTCCAGTTGGACCAGGG + Intergenic
1019327806 7:446746-446768 CTGGGTCCTCGGCTGGTGCAGGG - Intergenic
1019544509 7:1567056-1567078 GTCTGTCCCCAGCTGCAGCACGG + Intergenic
1023544667 7:41305772-41305794 TTGGTTCCCCAGAAGGAACAGGG - Intergenic
1026980743 7:74525265-74525287 TTGGGTCCCCAGCCTGGGCCAGG + Intronic
1027924739 7:84446946-84446968 CTGGGTCCCCAGCTGTGGCTGGG - Intronic
1032020357 7:128404369-128404391 CTGGGTCCCCAGCCAAAGCATGG + Intronic
1032436593 7:131905968-131905990 TTGAGTTCCCTGATGGAGCATGG - Intergenic
1036382833 8:8249485-8249507 TGGGTTCCACATCTGGAGCAGGG + Intergenic
1037579945 8:20239137-20239159 TTCTGTCCACAGCTGTAGCAAGG + Intergenic
1039788979 8:40859066-40859088 TTTCTTCCCCAGCTGGACCAGGG + Intronic
1040472115 8:47742466-47742488 TTGGGTGGCCATCTGGAGAATGG - Intergenic
1043745480 8:83869206-83869228 CTGGGTCTCCAGCAGCAGCAGGG - Intergenic
1044271440 8:90249200-90249222 TCCTGTCCCCAACTGGAGCATGG + Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1048447138 8:134499885-134499907 TGGTGTCCCCAGCTGGTGGAGGG - Intronic
1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG + Intronic
1049838151 8:144753751-144753773 TTGATCTCCCAGCTGGAGCAGGG - Exonic
1050489557 9:6173417-6173439 ATGGGTCCCCACCTGCAGCAAGG - Intergenic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053707337 9:40768568-40768590 TTGGGTCCCTGGCTGCAGGAGGG - Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054417251 9:64889336-64889358 TTGGGTCCCTGGCTGCAGGAGGG - Intergenic
1055820428 9:80255023-80255045 TAGGGCCTCCAGATGGAGCATGG + Intergenic
1056238579 9:84620650-84620672 ATGGTTTCCCAGCTTGAGCAAGG + Intergenic
1059325867 9:113503727-113503749 TTGGGACCCCAGCTTGTGCTTGG + Intronic
1060824221 9:126678441-126678463 GTGGGGCCCCAGCTGAAGCTGGG + Intronic
1060867013 9:127008460-127008482 TTGGGACCTCAGCAGGACCAGGG + Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062276819 9:135735322-135735344 TTGGACCCCCAGAGGGAGCAGGG + Intronic
1203522266 Un_GL000213v1:54999-55021 ATTGGTCCCCAGCTGCAGGAGGG + Intergenic
1187498033 X:19813245-19813267 TTGGCTCCTCAGCGAGAGCATGG - Intronic
1188479554 X:30623065-30623087 TTTGGTTCCCTGCTGGAGAAGGG - Intergenic
1188876369 X:35435403-35435425 TTGGGTCCCCAGCAGGGGATTGG + Intergenic
1188885696 X:35546736-35546758 TTGGGTCCTGAACTCGAGCATGG + Intergenic
1189104042 X:38219228-38219250 AGGGGTCCCCAGCTTGAGAAAGG + Intronic
1195479117 X:105322437-105322459 TTGTGTTCCCATCTGGAGCTTGG + Intronic
1196685307 X:118505531-118505553 TTGGGGCATCATCTGGAGCAAGG - Intronic
1197342649 X:125291627-125291649 TTGTGTCCCCAGATCTAGCACGG - Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1200052565 X:153442780-153442802 TCGGCTGCCCAGCTGGAGCCTGG + Intergenic