ID: 927214568

View in Genome Browser
Species Human (GRCh38)
Location 2:20660745-20660767
Sequence CCGGGTCAACACTCTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927214558_927214568 12 Left 927214558 2:20660710-20660732 CCCAGACACCAGGATCCGGTCAG No data
Right 927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG No data
927214559_927214568 11 Left 927214559 2:20660711-20660733 CCAGACACCAGGATCCGGTCAGC No data
Right 927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG No data
927214557_927214568 13 Left 927214557 2:20660709-20660731 CCCCAGACACCAGGATCCGGTCA No data
Right 927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG No data
927214555_927214568 18 Left 927214555 2:20660704-20660726 CCAATCCCCAGACACCAGGATCC No data
Right 927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG No data
927214560_927214568 4 Left 927214560 2:20660718-20660740 CCAGGATCCGGTCAGCCCTGTGA No data
Right 927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG No data
927214561_927214568 -3 Left 927214561 2:20660725-20660747 CCGGTCAGCCCTGTGATCCTCCG No data
Right 927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927214568 Original CRISPR CCGGGTCAACACTCTGTTTC AGG Intergenic
No off target data available for this crispr