ID: 927215846

View in Genome Browser
Species Human (GRCh38)
Location 2:20667425-20667447
Sequence CCCGGCCGCCGCGGTTCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927215840_927215846 1 Left 927215840 2:20667401-20667423 CCAGGCTGCGGGCGCCGCGGCTG 0: 1
1: 0
2: 1
3: 54
4: 389
Right 927215846 2:20667425-20667447 CCCGGCCGCCGCGGTTCCCCGGG 0: 1
1: 0
2: 3
3: 20
4: 217
927215839_927215846 2 Left 927215839 2:20667400-20667422 CCCAGGCTGCGGGCGCCGCGGCT 0: 1
1: 0
2: 1
3: 21
4: 225
Right 927215846 2:20667425-20667447 CCCGGCCGCCGCGGTTCCCCGGG 0: 1
1: 0
2: 3
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927215846 Original CRISPR CCCGGCCGCCGCGGTTCCCC GGG Exonic