ID: 927218216

View in Genome Browser
Species Human (GRCh38)
Location 2:20682046-20682068
Sequence TCCTGTGGACTCCTCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927218216_927218222 7 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA 0: 1
1: 0
2: 1
3: 13
4: 125
Right 927218222 2:20682076-20682098 GTGCGTGGCATAAGACCAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 94
927218216_927218223 13 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA 0: 1
1: 0
2: 1
3: 13
4: 125
Right 927218223 2:20682082-20682104 GGCATAAGACCAGGTGGCTATGG 0: 1
1: 0
2: 0
3: 12
4: 109
927218216_927218220 4 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA 0: 1
1: 0
2: 1
3: 13
4: 125
Right 927218220 2:20682073-20682095 CCCGTGCGTGGCATAAGACCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
927218216_927218218 -8 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA 0: 1
1: 0
2: 1
3: 13
4: 125
Right 927218218 2:20682061-20682083 CCACAGGAAGCTCCCGTGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 91
927218216_927218225 27 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA 0: 1
1: 0
2: 1
3: 13
4: 125
Right 927218225 2:20682096-20682118 TGGCTATGGAAGAGTTGCAGAGG 0: 1
1: 0
2: 0
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927218216 Original CRISPR TCCTGTGGACTCCTCTGTAC AGG (reversed) Intergenic
901404637 1:9038113-9038135 TCCTGGAGACGCCTCTGTCCTGG - Intronic
905441443 1:37998793-37998815 TCCTGGGGGCTACTATGTACAGG - Intronic
905635349 1:39547521-39547543 TCCTGTGGCACCCTCTGTCCTGG - Intergenic
908920370 1:69183847-69183869 TTCTGTGGACTCCTCTGGGATGG + Intergenic
909902546 1:81156280-81156302 TCATCTGGACTCCTCTGTAGGGG + Intergenic
916609741 1:166379753-166379775 TCCTGTAGATCCCTCTGCACTGG + Intergenic
920192530 1:204202698-204202720 TCCTGTGCCCTCCTCTGCCCAGG + Intronic
922876030 1:228940572-228940594 TCCTGGTGACGCATCTGTACTGG + Intergenic
923419758 1:233800883-233800905 TCCTCTGGTCTCCTGTGGACAGG - Intergenic
1063449912 10:6144632-6144654 TCTTGTGGACTCCACGGGACAGG - Intergenic
1064064208 10:12166866-12166888 TGCTGTGAACTACTCTGTATTGG + Exonic
1065535653 10:26712602-26712624 TTCTGTGGACTCTTCTGGATCGG + Intronic
1065900010 10:30197944-30197966 TCCTGTGGACATCACTGAACAGG + Intergenic
1067815429 10:49471934-49471956 TCCTGTCGACTTCTTTGTAAGGG + Intronic
1071113145 10:82186258-82186280 TCCCCTGGATTCCTCTTTACTGG - Intronic
1072944687 10:99799102-99799124 CCCCGTGGCCTTCTCTGTACAGG - Intronic
1073990113 10:109252965-109252987 TCCTGTGGACTCCACAGTTCAGG - Intergenic
1076189142 10:128470502-128470524 TCCTCTGGACTCTGCTGTGCCGG - Intergenic
1077304495 11:1863028-1863050 TGCTGTGGGCTCCTCTCTCCAGG + Intronic
1079417730 11:20255167-20255189 TTCTGTGGGCCACTCTGTACAGG + Intergenic
1080647864 11:34199914-34199936 TCCTGTGGACTCTTCCTTCCAGG + Intronic
1087108996 11:94442443-94442465 TCCTGTGGAATCCAGTGTCCTGG - Intronic
1090080118 11:123606713-123606735 TCCTGTGAACTCCCCTTCACTGG + Exonic
1100650514 12:96583749-96583771 GCCTTTGGACTGCTCTGTCCAGG + Intronic
1102576647 12:113860102-113860124 TCCTGGTGCCTCCTCTGTGCAGG + Intronic
1104069259 12:125330191-125330213 ACTTGTGGTCTCCTCTGTCCAGG + Intronic
1105326326 13:19373658-19373680 TCCTGGGGACTCCTGTGCAAAGG + Intergenic
1108896585 13:55335715-55335737 TCCTGAGGACTCCTCAGAAGTGG + Intergenic
1111684667 13:91487393-91487415 TCCTGTGGAAACATCTGTCCAGG + Intronic
1112834660 13:103499607-103499629 TTGTGTGGACTACTCAGTACGGG + Intergenic
1113982706 13:114289593-114289615 TCCAGTGGATTCTTCTGCACAGG + Intronic
1114024902 14:18516492-18516514 TGCTGTGGAATCCTCTGTGAGGG - Intergenic
1114043829 14:18704147-18704169 TACTGTGTACTCATCTGTCCTGG + Intergenic
1114114403 14:19507055-19507077 TACTGTGTACTCATCTGTCCTGG - Intergenic
1114116098 14:19624808-19624830 TACTGTGTACTCATCTGTCCTGG - Intergenic
1114525754 14:23366110-23366132 TCCTGTGGACTCGCCTGGGCTGG + Intergenic
1115859921 14:37673230-37673252 GCCTGTGGAATCCTCCTTACAGG - Intronic
1120525230 14:85569407-85569429 TCTAGTGGAGTCCTCTGTGCTGG + Intronic
1123631975 15:22267843-22267865 TCCTGGGGATTCCTCTGTGTAGG - Intergenic
1124926336 15:34073897-34073919 TCCTGTAGACTAAGCTGTACTGG - Intergenic
1125542711 15:40479557-40479579 TCCCGTGGACTTCTCTGCTCTGG - Intergenic
1127846999 15:62878681-62878703 TAATGAGGACTCCTCTGTAAAGG + Intergenic
1128681311 15:69653974-69653996 TCCTGGGCACTTCTCTGTTCAGG - Intergenic
1128739644 15:70074646-70074668 GCCTGTGACCTCCTCTGTCCAGG - Intronic
1130604090 15:85299145-85299167 TCCAGTGGACTGCACTGTCCAGG - Intergenic
1133776809 16:8903058-8903080 TCCTGTGGGTTCCCCTGTGCAGG + Intronic
1134180553 16:12044307-12044329 TGCTGTGGTCACCTCTCTACTGG + Intronic
1134353004 16:13455441-13455463 TTCTTTGGACTCCTTTTTACTGG - Intergenic
1135307295 16:21378056-21378078 TGCTGTGGTCACCTCTCTACTGG + Intergenic
1136304043 16:29357198-29357220 TGCTGTGGTCACCTCTCTACTGG + Intergenic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1141971022 16:87482543-87482565 TCCTGGGGATTCCTCTGTGTAGG + Intronic
1142023850 16:87801827-87801849 TCCTGTGGAGGCCTCTGGGCAGG - Intergenic
1143519435 17:7437199-7437221 TCCTGCGGACGCTGCTGTACTGG + Exonic
1145215891 17:21052086-21052108 TCCTGGGAACTCCTCAGTCCTGG + Intergenic
1145999446 17:29122539-29122561 TCCTGGGGTCTCCTCTTTCCTGG - Intronic
1146135500 17:30317327-30317349 TCCTGTGCACACCTCTGCACTGG + Intronic
1146374864 17:32287249-32287271 TGCTGTGCACTCCCCTGTGCAGG + Intronic
1154209458 18:12367055-12367077 TCCTCTGGACTGCTCTGTTCTGG - Exonic
1156096617 18:33540554-33540576 TCCTGTGGGCTCCACTCTGCAGG - Intergenic
1157363349 18:47039642-47039664 TTCTGTGTGCTCCTCAGTACTGG - Intronic
1158548237 18:58413887-58413909 TCCTGAGGACTGCTCTGTACAGG - Intergenic
1158620902 18:59031807-59031829 TCCTGTGGACCCATCTGTGATGG + Intergenic
1160505646 18:79425417-79425439 TCCTGTGGAGTCCTGTGGGCGGG + Intronic
1160511619 18:79456353-79456375 GCCTGGGGACTCCTCTGACCCGG - Intronic
1162256944 19:9498414-9498436 TCCTGCGGACTCCTGTGGAGTGG + Intronic
1167775229 19:51550231-51550253 TCCTGGGGACCCTTCTCTACTGG + Intergenic
1168403265 19:56098191-56098213 CCCTGGGGACACCTCTGAACAGG + Intronic
926436991 2:12848446-12848468 TCCAGTGGCCTCCTCTGGACTGG + Intergenic
927218216 2:20682046-20682068 TCCTGTGGACTCCTCTGTACAGG - Intergenic
930405704 2:50952958-50952980 TCCTGTGTACACCACTTTACTGG - Intronic
932380992 2:71282593-71282615 TTCTGTGAACTCTTCTGCACAGG + Intronic
932733783 2:74239823-74239845 TCCTGTGGACGCCTCCTTCCTGG + Intronic
932736629 2:74259124-74259146 TCCTGTGGTCTCCCATGAACTGG - Intronic
933168164 2:79097142-79097164 TCCAGTGGAGTCCTCTGCAGAGG + Intergenic
934973778 2:98786152-98786174 TCCAGTGGATACCTCTGCACTGG - Intergenic
936457145 2:112683678-112683700 TGCTGTGGGCTCCTCGGGACAGG + Intergenic
936509489 2:113133581-113133603 TAATCTGGACTCCTCTGTCCAGG + Exonic
937629891 2:124089308-124089330 TTCGTTGGACTACTCTGTACTGG + Intronic
938425487 2:131183104-131183126 TACTGTGTACTCATCTGTCCTGG + Intronic
938703344 2:133898651-133898673 TCCTCTGGAGGCCTCTATACAGG - Intergenic
940838106 2:158548104-158548126 GCCTGTGGAGTACTCTGTACAGG + Intronic
945720875 2:213416896-213416918 TCCTGTGGAAACCTCAGTAAAGG - Intronic
1171321307 20:24246868-24246890 CCCTCTGGATTTCTCTGTACTGG - Intergenic
1173249420 20:41356816-41356838 TCCTGTGGCCTGCACTGGACAGG + Intronic
1174845975 20:53943648-53943670 TCCTATTTACTCCTTTGTACAGG + Exonic
1175989483 20:62780703-62780725 ACCTGTGGAGTCCCCTGCACAGG + Intergenic
1180059908 21:45379439-45379461 TTCTCTGAACTCCTCTGTCCAGG + Intergenic
1180449068 22:15443973-15443995 TGCTGTGGAATCCTCTGTGAGGG - Intergenic
1180466650 22:15617263-15617285 TACTGTGTACTCATCTGTCCTGG + Intergenic
1184835378 22:47017959-47017981 GCCTGTGGACACCTCTGCAGTGG + Intronic
952164038 3:30726329-30726351 TCCTGTCATCTCCTCTTTACTGG - Exonic
953063058 3:39443780-39443802 TCCTGTGAGCACCTCTGTCCTGG + Intergenic
953770047 3:45772646-45772668 TCCTGTGGACCCCACTGCTCCGG - Intronic
960971296 3:123141935-123141957 TCCGGTGGTCTCCTTTGTCCTGG + Intronic
962412223 3:135151302-135151324 CCCTGTGGACTCCTCTCTTCTGG + Intronic
963441972 3:145352248-145352270 TTCTGTCGTCTCCTCTGTTCAGG - Intergenic
969938482 4:10706698-10706720 TTCTGTGGTCTCCTTTGTGCAGG + Intergenic
970746890 4:19309401-19309423 TCCTGTGGCCTCCTCAGCAGAGG - Intergenic
979963139 4:127045516-127045538 TCCTGTGGAGCATTCTGTACAGG + Intergenic
983666428 4:170189381-170189403 CCCAGTGGACTCCTCTGCACAGG - Intergenic
984631635 4:182067021-182067043 TACTGTGGATACCTCTGTTCTGG + Intergenic
985762139 5:1754748-1754770 TGCTGTGGACTCATCTCTCCAGG + Intergenic
986704780 5:10446049-10446071 GCCTGTGGACTCCACTGTGAGGG + Intronic
987927781 5:24364543-24364565 TTCTGTTCACTCCTCTGCACTGG - Intergenic
990125107 5:52506754-52506776 TCCCATGGACTCCTCTTTATAGG - Intergenic
995716128 5:115083325-115083347 GCCTGAGGTCTCCTATGTACAGG - Intergenic
996382401 5:122875524-122875546 TTCAGTGTACTCCTTTGTACGGG + Intronic
1001678974 5:173542479-173542501 TCCTGTGTGCTGCACTGTACTGG - Intergenic
1002719259 5:181247752-181247774 TCCTGTGGACTCCTCAGAAAAGG - Intronic
1005060489 6:21772623-21772645 TCCTGTGGAATTCTCTGAACAGG + Intergenic
1006407788 6:33855310-33855332 TCCTGTGGACACCTCCCAACTGG - Intergenic
1008652788 6:53580303-53580325 TCCTTTGGACTCCTGTTTTCAGG + Intronic
1011121122 6:83954154-83954176 TCCTGTGGAATACTCTCTCCTGG - Intronic
1016333183 6:142975508-142975530 ACCTCTGGACTCTTCTCTACAGG + Intergenic
1018010533 6:159665966-159665988 TTCTCTGGACTCCTGTGTAGAGG - Intergenic
1021876510 7:25054590-25054612 ACCTGCTGACTCCTCTGTCCCGG + Intergenic
1037266269 8:17064522-17064544 TCCTCTGAACTACTCTGTTCAGG - Intronic
1038521689 8:28238594-28238616 TCCTGTGGTTTGCTCTGAACTGG - Intergenic
1041137839 8:54779245-54779267 TCCTGTGTCCTCCTCTGTCAAGG + Intergenic
1047412426 8:124634813-124634835 TCCTGGGGACCCATCTGTGCTGG + Intronic
1048942920 8:139417995-139418017 TCCTGTGGCCTGCTCTGTTCTGG - Intergenic
1049946872 9:605597-605619 TCCTGTAATCTCTTCTGTACAGG + Intronic
1050168220 9:2788636-2788658 TCCTGAGGATTCCTCTCCACTGG - Intronic
1051784708 9:20729688-20729710 TCCTGAGGAGTCCTCTGCACTGG + Intronic
1055661582 9:78509009-78509031 TTCTGGGGTCTCCTCTGTAATGG - Intergenic
1057388083 9:94621942-94621964 TCCTGTGGACTTCTCCACACAGG + Intronic
1060203747 9:121669283-121669305 TTCTTGGGACTTCTCTGTACTGG - Intronic
1060886790 9:127160294-127160316 TCCTGTGGACACCTCTGGTGGGG + Intronic
1062395889 9:136352640-136352662 TCATCTGGACTCCTCTGTCCGGG - Intronic
1203496270 Un_GL000224v1:154450-154472 TGCTGCGGAATCCTCTGTAAGGG + Intergenic
1203508892 Un_KI270741v1:96372-96394 TGCTGCGGAATCCTCTGTAAGGG + Intergenic
1191054878 X:56231710-56231732 TCCTGTGGATTCAGCTTTACGGG + Intergenic
1191179442 X:57544599-57544621 TCCTTTGGATTGCTCTGTTCAGG - Intergenic
1198115150 X:133537494-133537516 TCCTGGGCCCTGCTCTGTACTGG - Intronic
1198759077 X:140012181-140012203 TCATGGGGACTCCTCTGGCCAGG + Intergenic
1198779667 X:140221391-140221413 TCATGGGGACTCCTCTGGCCAGG - Intergenic
1199590695 X:149465655-149465677 TCCTGAGGTCACCTCTGTAAGGG + Intergenic
1200978614 Y:9240248-9240270 TTCTGTGGGTTCCTCTGTTCGGG - Intergenic
1202605459 Y:26635954-26635976 TCCTGGGGACTCCTTTGCAAAGG - Intergenic