ID: 927218216

View in Genome Browser
Species Human (GRCh38)
Location 2:20682046-20682068
Sequence TCCTGTGGACTCCTCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927218216_927218223 13 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA No data
Right 927218223 2:20682082-20682104 GGCATAAGACCAGGTGGCTATGG No data
927218216_927218222 7 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA No data
Right 927218222 2:20682076-20682098 GTGCGTGGCATAAGACCAGGTGG No data
927218216_927218218 -8 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA No data
Right 927218218 2:20682061-20682083 CCACAGGAAGCTCCCGTGCGTGG No data
927218216_927218225 27 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA No data
Right 927218225 2:20682096-20682118 TGGCTATGGAAGAGTTGCAGAGG No data
927218216_927218220 4 Left 927218216 2:20682046-20682068 CCTGTACAGAGGAGTCCACAGGA No data
Right 927218220 2:20682073-20682095 CCCGTGCGTGGCATAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927218216 Original CRISPR TCCTGTGGACTCCTCTGTAC AGG (reversed) Intergenic