ID: 927218222 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:20682076-20682098 |
Sequence | GTGCGTGGCATAAGACCAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
927218216_927218222 | 7 | Left | 927218216 | 2:20682046-20682068 | CCTGTACAGAGGAGTCCACAGGA | No data | ||
Right | 927218222 | 2:20682076-20682098 | GTGCGTGGCATAAGACCAGGTGG | No data | ||||
927218217_927218222 | -8 | Left | 927218217 | 2:20682061-20682083 | CCACAGGAAGCTCCCGTGCGTGG | No data | ||
Right | 927218222 | 2:20682076-20682098 | GTGCGTGGCATAAGACCAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
927218222 | Original CRISPR | GTGCGTGGCATAAGACCAGG TGG | Intergenic | ||